Construct: ORF TRCN0000472980
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005847.1_s317c1
- Derived from:
- ccsbBroadEn_07457
- DNA Barcode:
- CAGTCCATCTTAATGCACCTGGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MTFR1 (9650)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472980
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9650 | MTFR1 | mitochondrial fission regul... | NM_014637.4 | 99.8% | 99.6% | 404T>G |
2 | human | 9650 | MTFR1 | mitochondrial fission regul... | NM_001145839.1 | 91.3% | 90.5% | (many diffs) |
3 | human | 9650 | MTFR1 | mitochondrial fission regul... | NM_001145838.1 | 89.9% | 89.7% | 65_66ins99;305T>G |
4 | human | 9650 | MTFR1 | mitochondrial fission regul... | XM_006716484.2 | 87.2% | 83.8% | (many diffs) |
5 | human | 9650 | MTFR1 | mitochondrial fission regul... | XM_011517626.2 | 87.2% | 83.8% | (many diffs) |
6 | human | 9650 | MTFR1 | mitochondrial fission regul... | XM_011517627.3 | 87.2% | 83.8% | (many diffs) |
7 | human | 9650 | MTFR1 | mitochondrial fission regul... | XM_011517628.2 | 75.7% | 67.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1065
- ORF length:
- 999
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct tggctggatt aagcgcctaa ttaggatggt ttttcaacaa gttggagtaa 121 gcatgcaatc ggtactttgg tctaggaagc catatggttc gtctcgaagt atcgtaagga 181 aaattggtac taatttgtct ctgattcagt gtccaagagt tcagtttcag attaacagcc 241 atgcaacaga atggagtccc agccacccag gagaggatgc agtggcgtct tttgctgatg 301 ttggatgggt agccaaagaa gaaggagagt gttcagcaag actaaggaca gaggtcagat 361 caaggccacc ccttcaggat gaccttcttt tctttgagaa ggccccaagc agacagattt 421 ccttaccaga cttgtctcaa gaagagcctc agctgaagac cccagcgcgg gcaaatgagg 481 aagcactgca gaagatttgc gctctcgaaa atgaacttgc tgctctcaga gctcagattg 541 ccaaaattgt gacccagcag gagcagcaaa atctcactgc aggtgactta gattctacca 601 catttggtac cataccacca caccctccac ctcccccacc gcccctgcct ccccctgcac 661 tggggctcca ccaaagtaca tctgctgttg atcTGATTAA AGAACGAAGA GAGAAAAGAG 721 CCAATGCTGG AAAGACTTTG GTTAAGAACA ATCCAAAGAA ACCTGAAATG CCAAATATGC 781 TAGAGATCCT TAAAGAGATG AACAGTGTAA AACTTCGGTC AGTGAAGAGG TCAGAGCAAG 841 ATGTGAAGCC CAAGCCAGTG GATGCTACTG ACCCTGCTGC CCTCATAGCA GAGGCTCTGA 901 AAAAGAAATT TGCTTATCGG TATCGAAGTG ATAGCCAAGA TGAAGTTGAA AAAGGAATTC 961 CAAAGTCTGA ATCAGAGGCC ACCTCAGAGA GAGTGTTGTT TGGGCCACAC ATGTTGAAGC 1021 CAACAGGAAA AATGAAGGCT TTAATTGAAA ATGTATCAGA CTCCTACCCA ACTTTCTTGT 1081 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1141 AGTAATGAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC 1201 AGTCCATCTT AATGCACCTG GCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa 1261 tttgtgaaag att