Transcript: Human NM_014637.4

Homo sapiens mitochondrial fission regulator 1 (MTFR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MTFR1 (9650)
Length:
2651
CDS:
132..1133

Additional Resources:

NCBI RefSeq record:
NM_014637.4
NBCI Gene record:
MTFR1 (9650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014637.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121968 CCAGTAGTGATGAATCAAATT pLKO.1 1848 3UTR 100% 13.200 18.480 N MTFR1 n/a
2 TRCN0000143543 GCTTATCGGTATCGAAGTGAT pLKO.1 978 CDS 100% 4.950 6.930 N MTFR1 n/a
3 TRCN0000343176 GCTTATCGGTATCGAAGTGAT pLKO_005 978 CDS 100% 4.950 6.930 N MTFR1 n/a
4 TRCN0000140320 CAGAAGATTTGCGCTCTCGAA pLKO.1 555 CDS 100% 2.640 3.696 N MTFR1 n/a
5 TRCN0000139067 CGGTATCGAAGTGATAGCCAA pLKO.1 984 CDS 100% 2.640 3.696 N MTFR1 n/a
6 TRCN0000144079 CAGTTTCAGATTAACAGCCAT pLKO.1 288 CDS 100% 2.640 2.112 N MTFR1 n/a
7 TRCN0000144655 GCACTGTTATCTTCGTTTGTT pLKO.1 1555 3UTR 100% 5.625 3.938 N MTFR1 n/a
8 TRCN0000343177 GCACTGTTATCTTCGTTTGTT pLKO_005 1555 3UTR 100% 5.625 3.938 N MTFR1 n/a
9 TRCN0000145051 CAAAGTACATCTGCTGTTGAT pLKO.1 738 CDS 100% 4.950 3.465 N MTFR1 n/a
10 TRCN0000122749 CCAAAGTACATCTGCTGTTGA pLKO.1 737 CDS 100% 4.950 3.465 N MTFR1 n/a
11 TRCN0000144457 CCATCTTGTTTCCTTTCAGTT pLKO.1 1912 3UTR 100% 4.950 3.465 N MTFR1 n/a
12 TRCN0000143523 GAGAGTGTTCAGCAAGACTAA pLKO.1 391 CDS 100% 4.950 3.465 N MTFR1 n/a
13 TRCN0000343121 GAGAGTGTTCAGCAAGACTAA pLKO_005 391 CDS 100% 4.950 3.465 N MTFR1 n/a
14 TRCN0000144704 GCAACATAAACCATAGGTGTT pLKO.1 2091 3UTR 100% 4.050 2.835 N MTFR1 n/a
15 TRCN0000343116 GCAACATAAACCATAGGTGTT pLKO_005 2091 3UTR 100% 4.050 2.835 N MTFR1 n/a
16 TRCN0000139921 GCTTCCCATTGAAGGGAAGTT pLKO.1 1760 3UTR 100% 0.495 0.347 N MTFR1 n/a
17 TRCN0000145407 GATAGCCAAGATGAAGTTGAA pLKO.1 996 CDS 100% 4.950 2.970 N MTFR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014637.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02220 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02220 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467790 GGGCTCTTACGGAATCGCGGTTCT pLX_317 35.2% 100% 100% V5 n/a
4 ccsbBroadEn_07457 pDONR223 100% 99.8% 99.6% None 404T>G n/a
5 ccsbBroad304_07457 pLX_304 0% 99.8% 99.6% V5 404T>G n/a
6 TRCN0000472980 CAGTCCATCTTAATGCACCTGGCA pLX_317 37.4% 99.8% 99.6% V5 404T>G n/a
Download CSV