Construct: ORF TRCN0000472992
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012628.4_s317c1
- Derived from:
- ccsbBroadEn_12512
- DNA Barcode:
- TAGGTCACTCTCTATATAGACAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WNK1 (65125)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472992
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019839.1 | 19% | 18.8% | (many diffs) |
| 2 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521009.2 | 18.5% | 18.2% | (many diffs) |
| 3 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521008.2 | 18.5% | 18.2% | (many diffs) |
| 4 | human | 65125 | WNK1 | WNK lysine deficient protei... | NM_014823.3 | 18.2% | 18% | (many diffs) |
| 5 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019838.1 | 18.2% | 18% | (many diffs) |
| 6 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019837.1 | 18.2% | 18% | (many diffs) |
| 7 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019836.1 | 17.7% | 17.4% | (many diffs) |
| 8 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019835.1 | 17.7% | 17.4% | (many diffs) |
| 9 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019834.1 | 17.5% | 17.2% | (many diffs) |
| 10 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521007.2 | 16.5% | 16.3% | (many diffs) |
| 11 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521006.2 | 16.5% | 16.3% | (many diffs) |
| 12 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_006719003.2 | 16.3% | 16.1% | (many diffs) |
| 13 | human | 65125 | WNK1 | WNK lysine deficient protei... | NM_018979.4 | 16.3% | 16.1% | (many diffs) |
| 14 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521004.2 | 15.3% | 15.1% | (many diffs) |
| 15 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521003.2 | 15.3% | 15% | (many diffs) |
| 16 | human | 65125 | WNK1 | WNK lysine deficient protei... | NM_213655.4 | 14.8% | 14.6% | (many diffs) |
| 17 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521002.2 | 14.7% | 14.5% | (many diffs) |
| 18 | human | 65125 | WNK1 | WNK lysine deficient protei... | NM_001184985.1 | 14.7% | 14.5% | (many diffs) |
| 19 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521001.2 | 14.4% | 14.2% | (many diffs) |
| 20 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521000.2 | 14.2% | 14% | (many diffs) |
| 21 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011520998.2 | 13.9% | 13.7% | (many diffs) |
| 22 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011520999.2 | 13.9% | 13.7% | (many diffs) |
| 23 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011520997.3 | 13.9% | 13.7% | (many diffs) |
| 24 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_001185020.1 | 15.8% | 16.7% | (many diffs) |
| 25 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321557.1 | 15.8% | 16.7% | (many diffs) |
| 26 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321556.1 | 15.4% | 16.3% | (many diffs) |
| 27 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321555.1 | 15.4% | 16.2% | (many diffs) |
| 28 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_001185021.1 | 15.3% | 16.1% | (many diffs) |
| 29 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321554.1 | 15.3% | 16.1% | (many diffs) |
| 30 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321553.1 | 15.1% | 15.9% | (many diffs) |
| 31 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321552.1 | 14.8% | 15.6% | (many diffs) |
| 32 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321550.1 | 14.5% | 15.3% | (many diffs) |
| 33 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_198703.3 | 14.1% | 14.9% | (many diffs) |
| 34 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321549.1 | 14.1% | 14.9% | (many diffs) |
| 35 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321548.1 | 14.1% | 14.8% | (many diffs) |
| 36 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321547.1 | 14% | 14.8% | (many diffs) |
| 37 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321546.1 | 14% | 14.7% | (many diffs) |
| 38 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321545.1 | 13.9% | 14.7% | (many diffs) |
| 39 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321544.1 | 13.9% | 14.6% | (many diffs) |
| 40 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321543.1 | 13.9% | 14.6% | (many diffs) |
| 41 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_011241320.2 | 13.8% | 14.6% | (many diffs) |
| 42 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321542.1 | 13.8% | 14.6% | (many diffs) |
| 43 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_001199083.1 | 12.8% | 13.5% | (many diffs) |
| 44 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_001199084.1 | 12.8% | 13.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1245
- ORF length:
- 1179
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tggcggcgcc gcagagaagc agagcagcac tcccggttcc ctgttcctct 121 cgccgccggc tcctgccccc aagaatggct ccagctccga ttcctccgtg ggggagaaac 181 tgggagccgc ggccgccgac gctgtgaccg gcaggaccga ggagtacagg cgccgccgcc 241 acactatgga caaggacagc cgtggggcgg ccgcgaccac taccaccact gagcaccgct 301 tcttccgccg gagcgtcatc tgcgactcca atgccactgc actggagctt cccggccttc 361 ctctttccct gccccagccc agcatccccg cggctgtccc gcagagtgct ccaccggagc 421 cccaccggga agagaccgtg accgccaccg ccacttccca ggtagcccag cagcctccag 481 ccgctgccgc ccctggggaa caggccgtcg cgggccctgc cccctcgact gtccccagca 541 gtaccagcaa agaccgccca gtgtcccagc ctagccttgt ggggagcaaa gaggagccgc 601 cgccggcgag aagtggcagc ggcggcggca gcgccaagga gccacaggag gaacggagcc 661 agcagcagga tgatatcgaa gagctggaga ccaaggccgt gggaatgtct aacgatggcc 721 gctttctcaa gtttgacatc gaaatcggca gaggctcctt taagacggtc tacaaaggTC 781 TGGACACTGA AACCACCGTG GAAGTCGCCT GGTGTGAACT GCAGGATCGA AAATTAACAA 841 AGTCTGAGAG GCAGAGATTT AAAGAAGAAG CTGAAATGTT AAAAGGTCTT CAGCATCCCA 901 ATATTGTTAG ATTTTATGAT TCCTGGGAAT CCACAGTAAA AGGAAAGAAG TGCATTGTTT 961 TGGTGACTGA ACTTATGACG TCTGGAACAC TTAAAACGTA TCTGAAAAGG TTTAAAGTGA 1021 TGAAGATCAA AGTTCTAAGA AGCTGGTGCC GTCAGATCCT TAAAGGTCTT CAGTTTCTTC 1081 ATACTCGAAC TCCACCTATC ATTCACCGCG ATCTTAAATG TGACAACATC TTTATCACCG 1141 GCCCTACTGG CTCAGTCAAG ATTGGAGACC TCGGTCTGGC AACCCTGAAG CGGGCTTCTT 1201 TTGCCAAGAG TGTGATAGGT ATGTTTCAGG TGTACCTTGG AGCCTGCCCA ACTTTCTTGT 1261 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1321 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1381 GAAAGGACGA TAGGTCACTC TCTATATAGA CAGCACGCGT TAAGTCgaca atcaacctct 1441 ggattacaaa atttgtgaaa gatt