Transcript: Mouse XM_017321548.1

PREDICTED: Mus musculus WNK lysine deficient protein kinase 1 (Wnk1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wnk1 (232341)
Length:
10461
CDS:
885..8060

Additional Resources:

NCBI RefSeq record:
XM_017321548.1
NBCI Gene record:
Wnk1 (232341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432941 GCTGCATTTAACTGGTTATTT pLKO_005 8159 3UTR 100% 15.000 21.000 N WNK1 n/a
2 TRCN0000027001 CCGTCCAGAATCTAAGTCAAA pLKO.1 6994 CDS 100% 4.950 3.960 N Wnk1 n/a
3 TRCN0000345026 CCGTCCAGAATCTAAGTCAAA pLKO_005 6994 CDS 100% 4.950 3.960 N Wnk1 n/a
4 TRCN0000027039 GCTGCGTATTGAAGATATTAA pLKO.1 2393 CDS 100% 15.000 10.500 N Wnk1 n/a
5 TRCN0000345022 GCTGCGTATTGAAGATATTAA pLKO_005 2393 CDS 100% 15.000 10.500 N Wnk1 n/a
6 TRCN0000027035 CGTCAGTATCAGTCCCTATAA pLKO.1 4924 CDS 100% 13.200 9.240 N Wnk1 n/a
7 TRCN0000345096 CGTCAGTATCAGTCCCTATAA pLKO_005 4924 CDS 100% 13.200 9.240 N Wnk1 n/a
8 TRCN0000027023 GCAACCTAGTATATCTGTGTT pLKO.1 2816 CDS 100% 4.950 3.465 N Wnk1 n/a
9 TRCN0000345023 GCAACCTAGTATATCTGTGTT pLKO_005 2816 CDS 100% 4.950 3.465 N Wnk1 n/a
10 TRCN0000027020 CCCATTTGAATGGGCCATCTT pLKO.1 6883 CDS 100% 0.495 0.347 N Wnk1 n/a
11 TRCN0000345097 CCCATTTGAATGGGCCATCTT pLKO_005 6883 CDS 100% 0.495 0.347 N Wnk1 n/a
12 TRCN0000000921 GCATCCATTCTACAGTCCTAT pLKO.1 3772 CDS 100% 4.950 3.960 N WNK1 n/a
13 TRCN0000195072 CAGCCTTATGTGGAATCAAAT pLKO.1 3852 CDS 100% 13.200 9.240 N WNK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488638 CTAACCAACAACCCCTTGACATTA pLX_317 5.4% 85.2% 84.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489834 TCAGCAGATTTAACTTCAGGATAC pLX_317 36.9% 14.1% 14.8% V5 (many diffs) n/a
3 ccsbBroadEn_12512 pDONR223 100% 14.1% 14.8% None (many diffs) n/a
4 ccsbBroad304_12512 pLX_304 0% 14.1% 14.8% V5 (many diffs) n/a
5 TRCN0000472992 TAGGTCACTCTCTATATAGACAGC pLX_317 39.7% 14.1% 14.8% V5 (many diffs) n/a
6 ccsbBroadEn_15140 pDONR223 0% 14.1% 14.8% None (many diffs) n/a
7 ccsbBroad304_15140 pLX_304 0% 14.1% 14.8% V5 (many diffs) n/a
8 TRCN0000471787 ACGTGGTTCACAAACTTTGGTTAG pLX_317 30.7% 14.1% 14.8% V5 (many diffs) n/a
9 TRCN0000489284 GCGGTGAGATTTCGAGTGCTTGCG pLX_317 34.2% 14.1% 14.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV