Transcript: Human NM_014823.3

Homo sapiens WNK lysine deficient protein kinase 1 (WNK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
WNK1 (65125)
Length:
10052
CDS:
988..7392

Additional Resources:

NCBI RefSeq record:
NM_014823.3
NBCI Gene record:
WNK1 (65125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148217 GCCGTGGGAATGTCTAACGA pXPR_003 TGG 647 10% 1 0.6429 WNK1 WNK1 75624
2 BRDN0001147437 GCTGATGGGACGGTTGACAG pXPR_003 TGG 1967 31% 8 0.2452 WNK1 WNK1 75623
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014823.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196491 GCAGGAGTGTCTAGTTATATT pLKO.1 4909 CDS 100% 15.000 21.000 N WNK1 n/a
2 TRCN0000219718 TCTGCGGGAAGGCGGTTTATA pLKO.1 4003 CDS 100% 15.000 21.000 N WNK1 n/a
3 TRCN0000423109 CCTAGAGACATTAACTGAATA pLKO_005 7394 3UTR 100% 13.200 18.480 N WNK1 n/a
4 TRCN0000000919 CCGCGATCTTAAATGTGACAA pLKO.1 2028 CDS 100% 4.950 6.930 N WNK1 n/a
5 TRCN0000219720 CCTTGTAATGGGTAGTTATTA pLKO.1 9097 3UTR 100% 15.000 12.000 N WNK1 n/a
6 TRCN0000432941 GCTGCATTTAACTGGTTATTT pLKO_005 7488 3UTR 100% 15.000 10.500 N WNK1 n/a
7 TRCN0000417569 ATGAATCCGTTGACGTTTATG pLKO_005 2186 CDS 100% 13.200 9.240 N WNK1 n/a
8 TRCN0000000918 CCGAGGAGATAGCAACAATTA pLKO.1 3713 CDS 100% 13.200 9.240 N WNK1 n/a
9 TRCN0000420946 GACCATGCTTTCCTGTTTATC pLKO_005 7631 3UTR 100% 13.200 9.240 N WNK1 n/a
10 TRCN0000219719 GTTGCAGGATCATAATCTATT pLKO.1 8967 3UTR 100% 13.200 9.240 N WNK1 n/a
11 TRCN0000197201 GCACAAGTTGGTAGACAATTG pLKO.1 6993 CDS 100% 10.800 7.560 N WNK1 n/a
12 TRCN0000000920 GCGTAGTTTCAAGTATCACAA pLKO.1 4478 CDS 100% 4.950 3.465 N WNK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014823.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488638 CTAACCAACAACCCCTTGACATTA pLX_317 5.4% 89.4% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489834 TCAGCAGATTTAACTTCAGGATAC pLX_317 36.9% 18.2% 18% V5 (many diffs) n/a
3 ccsbBroadEn_12512 pDONR223 100% 18.2% 18% None (many diffs) n/a
4 ccsbBroad304_12512 pLX_304 0% 18.2% 18% V5 (many diffs) n/a
5 TRCN0000472992 TAGGTCACTCTCTATATAGACAGC pLX_317 39.7% 18.2% 18% V5 (many diffs) n/a
6 ccsbBroadEn_15140 pDONR223 0% 18.2% 18% None (many diffs) n/a
7 ccsbBroad304_15140 pLX_304 0% 18.2% 18% V5 (many diffs) n/a
8 TRCN0000471787 ACGTGGTTCACAAACTTTGGTTAG pLX_317 30.7% 18.2% 18% V5 (many diffs) n/a
9 TRCN0000489284 GCGGTGAGATTTCGAGTGCTTGCG pLX_317 34.2% 18.2% 18% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV