Construct: ORF TRCN0000473079
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015594.1_s317c1
- Derived from:
- ccsbBroadEn_08364
- DNA Barcode:
- GTAGGGCATTGGTTACATATACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NANS (54187)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473079
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54187 | NANS | N-acetylneuraminate synthase | NM_018946.4 | 99.8% | 99.7% | 153T>C;204G>C |
| 2 | human | 54187 | NANS | N-acetylneuraminate synthase | XM_011518787.2 | 67.6% | 67.6% | 0_1ins348 |
| 3 | human | 54187 | NANS | N-acetylneuraminate synthase | XM_024447574.1 | 67.6% | 67.6% | 0_1ins348 |
| 4 | human | 54187 | NANS | N-acetylneuraminate synthase | XM_011518788.2 | 65% | 59.3% | 0_1ins376;66delA |
| 5 | human | 54187 | NANS | N-acetylneuraminate synthase | XM_017014811.1 | 60.2% | 58.4% | (many diffs) |
| 6 | mouse | 94181 | Nans | N-acetylneuraminic acid syn... | NM_053179.3 | 88.5% | 94.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1143
- ORF length:
- 1077
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gctggagctg gagctgtgtc ccgggcgctg ggtgggcggg caacacccgt 121 gcttcatcat tgccgagatc ggccagaacc accagggcga cctggacgta gccaagcgca 181 tgatccgcat ggccaaggag tgtggggctg attgtgccaa gttccagaag agtgagctag 241 aattcaagtt taatcggaaa gccttggaca ggccatacac ctcgaagcat tcctggggga 301 agacgtacgg ggagcacaaa cgacatctgg agttcagcca tgaccagtac agggagctgc 361 agaggtacgc cgaggaggtt gggatcttct tcactgcctc tggcatggat gagatggcag 421 ttgaattcct gcatgaactg aatgttccat ttttcaaagt tggatctgga gacactaata 481 attttcctta tctggaaaag acagccaaaa aaggtcgccc aatggtgatc tccagtggga 541 tgcagtcaat ggacaccatg aagcaagttt atcagatcgt gaagcccctc aaccccaact 601 tctgcttctt gcagtgtacc agcgcatacc cgctccagcc tgaggacgtc aacctgcggg 661 tcatctcgga atatcagaag ctctttcctg acattcccat agggtattct gggcatgaaa 721 caggcatagc gatatctgtg gccgcagtgg ctctgggggc caaggtgttg gaacgtcaca 781 taactttgga caagacctgg aaggggagtg accactcggc ctcgctggag cctGGAGAAC 841 TGGCCGAGCT GGTGCGGTCA GTGCGTCTTG TGGAGCGTGC CCTGGGCTCC CCAACCAAGC 901 AGCTGCTGCC CTGTGAGATG GCCTGCAATG AGAAGCTGGG CAAGTCTGTG GTGGCCAAAG 961 TGAAAATTCC GGAAGGCACC ATTCTAACAA TGGACATGCT CACCGTGAAG GTGGGTGAGC 1021 CCAAAGGCTA TCCTCCTGAA GACATCTTTA ATCTAGTGGG CAAGAAGGTC CTGGTCACTG 1081 TTGAAGAGGA TGACACCATC ATGGAAGAAT TGGTAGATAA TCATGGCAAA AAAATCAAGT 1141 CTTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1201 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1261 GGCTTTATAT ATCTTGTGGA AAGGACGAGT AGGGCATTGG TTACATATAC TTACGCGTTA 1321 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt