Transcript: Human XM_011518787.2

PREDICTED: Homo sapiens N-acetylneuraminate synthase (NANS), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NANS (54187)
Length:
996
CDS:
237..968

Additional Resources:

NCBI RefSeq record:
XM_011518787.2
NBCI Gene record:
NANS (54187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045440 GCATGAAACAGGCATAGCGAT pLKO.1 536 CDS 100% 2.640 3.696 N NANS n/a
2 TRCN0000315742 GCATGAAACAGGCATAGCGAT pLKO_005 536 CDS 100% 2.640 3.696 N NANS n/a
3 TRCN0000045442 GACACCATGAAGCAAGTTTAT pLKO.1 375 CDS 100% 13.200 9.240 N NANS n/a
4 TRCN0000315743 GACACCATGAAGCAAGTTTAT pLKO_005 375 CDS 100% 13.200 9.240 N NANS n/a
5 TRCN0000045439 CATGAACTGAATGTTCCATTT pLKO.1 255 CDS 100% 10.800 7.560 N NANS n/a
6 TRCN0000315744 CATGAACTGAATGTTCCATTT pLKO_005 255 CDS 100% 10.800 7.560 N NANS n/a
7 TRCN0000045438 CACCATTCTAACAATGGACAT pLKO.1 800 CDS 100% 0.405 0.284 N NANS n/a
8 TRCN0000315741 CACCATTCTAACAATGGACAT pLKO_005 800 CDS 100% 0.405 0.284 N NANS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08364 pDONR223 100% 67.6% 67.6% None 0_1ins348 n/a
2 ccsbBroad304_08364 pLX_304 0% 67.6% 67.6% V5 0_1ins348 n/a
3 TRCN0000473079 GTAGGGCATTGGTTACATATACTT pLX_317 29.1% 67.6% 67.6% V5 0_1ins348 n/a
Download CSV