Transcript: Mouse NM_053179.3

Mus musculus N-acetylneuraminic acid synthase (sialic acid synthase) (Nans), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nans (94181)
Length:
1904
CDS:
31..1110

Additional Resources:

NCBI RefSeq record:
NM_053179.3
NBCI Gene record:
Nans (94181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075929 CGACTGCGCTAAGTTTCAGAA pLKO.1 174 CDS 100% 4.950 6.930 N Nans n/a
2 TRCN0000354078 CGACTGCGCTAAGTTTCAGAA pLKO_005 174 CDS 100% 4.950 6.930 N Nans n/a
3 TRCN0000075930 GCAGTTGAGTTTCTGCACGAA pLKO.1 382 CDS 100% 2.640 2.112 N Nans n/a
4 TRCN0000326010 GCAGTTGAGTTTCTGCACGAA pLKO_005 382 CDS 100% 2.640 2.112 N Nans n/a
5 TRCN0000075931 CTGGTCACTATCGAAGAAGAT pLKO.1 1036 CDS 100% 4.950 3.465 N Nans n/a
6 TRCN0000325941 CTGGTCACTATCGAAGAAGAT pLKO_005 1036 CDS 100% 4.950 3.465 N Nans n/a
7 TRCN0000075932 GCAAGTCTATCAGATCGTGAA pLKO.1 528 CDS 100% 4.050 2.835 N Nans n/a
8 TRCN0000326009 GCAAGTCTATCAGATCGTGAA pLKO_005 528 CDS 100% 4.050 2.835 N Nans n/a
9 TRCN0000075928 GTTGACATCTTCAGCCTTCAA pLKO.1 1335 3UTR 100% 4.950 2.970 N Nans n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08364 pDONR223 100% 88.5% 94.4% None (many diffs) n/a
2 ccsbBroad304_08364 pLX_304 0% 88.5% 94.4% V5 (many diffs) n/a
3 TRCN0000473079 GTAGGGCATTGGTTACATATACTT pLX_317 29.1% 88.5% 94.4% V5 (many diffs) n/a
Download CSV