Construct: ORF TRCN0000473184
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002718.1_s317c1
- Derived from:
- ccsbBroadEn_06866
- DNA Barcode:
- ATGTAAACCCGCCACCGACTTCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RNASE3 (6037)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473184
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6037 | RNASE3 | ribonuclease A family member 3 | NM_002935.2 | 99.7% | 99.3% | 371C>G |
| 2 | human | 6036 | RNASE2 | ribonuclease A family member 2 | NM_002934.3 | 85.1% | 69.5% | (many diffs) |
| 3 | human | 643332 | ECRP | ribonuclease A family membe... | NR_033909.1 | 68.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 549
- ORF length:
- 480
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggttccaaaa ctgttcactt cccaaatttg tctgcttctt ctgttggggc 121 ttatgggtgt ggagggctca ctccatgcca gacccccaca gtttacgagg gctcagtggt 181 ttgccatcca gcacatcagt ctgaaccccc ctcgatgcac cattgcaatg cgggcaatta 241 acaattatcg atggcgttgc aaaaaccaaa atacttttct tcgtacaact tttgctaatg 301 tagttaatgt ttgtggtaac CAAAGTATAC GCTGCCCTCA TAACAGAACT CTCAACAATT 361 GTCATCGGAG TAGATTCCGG GTGCCTTTAC TCCACTGTGA CCTCATAAAT CCAGGTGCAC 421 AGAATATTTC AAACTGCAGG TATGCAGACA GACCAGGAAG GAGGTTCTAT GTAGTTGCAT 481 GTGACAACAG AGATCCACGG GATTCTCCAC GGTATCCTGT GGTTCCAGTT CACCTGGATA 541 CCACCATCTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 601 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 661 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATGTAA ACCCGCCACC GACTTCTCAC 721 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt