Transcript: Human NM_002935.2

Homo sapiens ribonuclease A family member 3 (RNASE3), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
RNASE3 (6037)
Length:
716
CDS:
55..537

Additional Resources:

NCBI RefSeq record:
NM_002935.2
NBCI Gene record:
RNASE3 (6037)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002935.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049790 CTCCACTGTGACCTCATAAAT pLKO.1 376 CDS 100% 15.000 10.500 N RNASE3 n/a
2 TRCN0000418718 GACCAGGAAGGAGGTTCTATG pLKO_005 437 CDS 100% 10.800 7.560 N RNASE3 n/a
3 TRCN0000419481 GAGTAGATTCCGGGTGCCTTT pLKO_005 354 CDS 100% 4.050 2.835 N RNASE3 n/a
4 TRCN0000436537 CAATTATCGATGGCGTTGCAA pLKO_005 228 CDS 100% 3.000 2.100 N RNASE3 n/a
5 TRCN0000049791 CCACGGGATTCTCCACGGTAT pLKO.1 481 CDS 100% 1.350 0.945 N RNASE3 n/a
6 TRCN0000049789 CCATTGCAATGCGGGCAATTA pLKO.1 206 CDS 100% 1.320 0.924 N RNASE3 n/a
7 TRCN0000049792 GTTTGTGGTAACCAAAGTATA pLKO.1 295 CDS 100% 13.200 7.920 N RNASE3 n/a
8 TRCN0000049788 CCCTCATAACAGAACTCTCAA pLKO.1 321 CDS 100% 4.950 2.475 Y RNASE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002935.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06866 pDONR223 100% 99.7% 99.3% None 371C>G n/a
2 ccsbBroad304_06866 pLX_304 0% 99.7% 99.3% V5 371C>G n/a
3 TRCN0000473184 ATGTAAACCCGCCACCGACTTCTC pLX_317 47.5% 99.7% 99.3% V5 371C>G n/a
4 ccsbBroadEn_01405 pDONR223 100% 84.9% 68.9% None (many diffs) n/a
5 ccsbBroad304_01405 pLX_304 0% 84.9% 68.9% V5 (many diffs) n/a
6 TRCN0000476573 AGTCGATAAGCCTCGTACCGGTCA pLX_317 44.8% 84.9% 68.9% V5 (many diffs) n/a
Download CSV