Transcript: Human NM_002934.3

Homo sapiens ribonuclease A family member 2 (RNASE2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RNASE2 (6036)
Length:
720
CDS:
56..541

Additional Resources:

NCBI RefSeq record:
NM_002934.3
NBCI Gene record:
RNASE2 (6036)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002934.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373380 TATGACCTGTCCTAGTAACAA pLKO_005 313 CDS 100% 5.625 7.875 N RNASE2 n/a
2 TRCN0000049779 CCAATGCAATGCAGGTCATTA pLKO.1 207 CDS 100% 13.200 9.240 N RNASE2 n/a
3 TRCN0000373381 GGAAGCCAGGTGCCTTTAATC pLKO_005 359 CDS 100% 13.200 9.240 N RNASE2 n/a
4 TRCN0000049778 CCTGGGCTCAATGGTTTGAAA pLKO.1 153 CDS 100% 5.625 3.938 N RNASE2 n/a
5 TRCN0000049782 GCAATGCAGGTCATTAACAAT pLKO.1 212 CDS 100% 5.625 3.938 N RNASE2 n/a
6 TRCN0000373382 CAGCACATCAATATGACCTCC pLKO_005 176 CDS 100% 2.160 1.512 N RNASE2 n/a
7 TRCN0000049781 CCTCCACAGTATCCGGTGGTT pLKO.1 494 CDS 100% 0.880 0.528 N RNASE2 n/a
8 TRCN0000049780 CAACTCCAAGTCCACAGAATA pLKO.1 393 CDS 100% 13.200 6.600 Y RNASE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002934.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01405 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01405 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476573 AGTCGATAAGCCTCGTACCGGTCA pLX_317 44.8% 100% 100% V5 n/a
4 ccsbBroadEn_06866 pDONR223 100% 85.1% 69.5% None (many diffs) n/a
5 ccsbBroad304_06866 pLX_304 0% 85.1% 69.5% V5 (many diffs) n/a
6 TRCN0000473184 ATGTAAACCCGCCACCGACTTCTC pLX_317 47.5% 85.1% 69.5% V5 (many diffs) n/a
Download CSV