Construct: ORF TRCN0000473187
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005258.1_s317c1
- Derived from:
- ccsbBroadEn_01765
- DNA Barcode:
- TTATCACACTCCAAAGTGCATAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VDAC2 (7417)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473187
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001184823.1 | 100% | 100% | |
2 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001324088.1 | 100% | 100% | |
3 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_003375.4 | 100% | 100% | |
4 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001184783.2 | 93.9% | 90.4% | (many diffs) |
5 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001324087.1 | 84.9% | 83.3% | (many diffs) |
6 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001324089.1 | 84.9% | 83.3% | (many diffs) |
7 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001324090.1 | 84.9% | 83.3% | (many diffs) |
8 | mouse | 22334 | Vdac2 | voltage-dependent anion cha... | NM_011695.2 | 89.1% | 94.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 948
- ORF length:
- 882
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gacccacgga cagacttgcg cgcgtccaat gtgtattcct ccatcatatg 121 ctgaccttgg caaagctgcc agagatattt tcaacaaagg atttggtttt gggttggtga 181 aactggatgt gaaaacaaag tcttgcagtg gcgtggaatt ttcaacgtcc ggttcatcta 241 atacagacac tggtaaagtt actgggacct tggagaccaa atacaagtgg tgtgagtatg 301 gtctgacttt cacagaaaag tggaacactg ataacactct gggaacagaa atcgcaattg 361 aagaccagat ttgtcaaggt ttgaaactga catttgatac taccttctca ccaaacacag 421 gaaagaaaag tggtaaaatc aagtcttctt acaagaggga gtgtataaac cttggttgtg 481 atgttgactt tgattttgct ggacctgcaa tccatggttc agctgtcttt ggttatgagg 541 gctggcttgc tggctaccag atgacctttg acagtgccaa atcaaagctg acaaggaata 601 actttgcagt gggctacagg actggggact tccagctaca cactaatgtc aatgatggga 661 cagaatttgg aggatcaatt tatcagaaag tttgtgaaga tcttgacact tcagtaaacc 721 ttgcttggac atcaggtacc aactgcactc gttttggcat tgcagctaaa tatcagttgg 781 atcccactgc ttccatttct gcaaaagtca acaactctag cttaattgga gtaggctata 841 ctcagactct gaggcctggt gtgaagctta cactcTCTGC TCTGGTAGAT GGGAAGAGCA 901 TTAATGCTGG AGGCCACAAG GTTGGGCTCG CCCTGGAGTT GGAGGCTTAC CCAACTTTCT 961 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1021 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1081 GTGGAAAGGA CGATTATCAC ACTCCAAAGT GCATAGAACG CGTTAAGTCg acaatcaacc 1141 tctggattac aaaatttgtg aaagatt