Transcript: Mouse NM_011695.2

Mus musculus voltage-dependent anion channel 2 (Vdac2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Vdac2 (22334)
Length:
1662
CDS:
133..1020

Additional Resources:

NCBI RefSeq record:
NM_011695.2
NBCI Gene record:
Vdac2 (22334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427148 ATAACTAATGGCTCACGTATG pLKO_005 1477 3UTR 100% 6.000 8.400 N Vdac2 n/a
2 TRCN0000430572 GTAAACCTCGCTTGGACATCA pLKO_005 784 CDS 100% 4.950 6.930 N Vdac2 n/a
3 TRCN0000436609 ATGATGAAATAGACGTTTATG pLKO_005 1273 3UTR 100% 13.200 10.560 N Vdac2 n/a
4 TRCN0000364874 ACAGAATTTGGAGGATCAATT pLKO_005 730 CDS 100% 13.200 9.240 N VDAC2 n/a
5 TRCN0000427987 CAGAAGGTGATCACATCAAAG pLKO_005 1110 3UTR 100% 10.800 7.560 N Vdac2 n/a
6 TRCN0000431944 CATTGACTATTGTACTGAATG pLKO_005 1338 3UTR 100% 10.800 7.560 N Vdac2 n/a
7 TRCN0000425535 GAGAAGTGGAACACCGATAAC pLKO_005 385 CDS 100% 10.800 7.560 N Vdac2 n/a
8 TRCN0000426758 GCCATGGTGTGCATGTTTGTT pLKO_005 1302 3UTR 100% 5.625 3.938 N Vdac2 n/a
9 TRCN0000012412 GCTGTGATGTTGACTTTGATT pLKO.1 545 CDS 100% 5.625 3.938 N Vdac2 n/a
10 TRCN0000012410 CAAGTACAAATGGTGTGAGTA pLKO.1 348 CDS 100% 4.950 3.465 N Vdac2 n/a
11 TRCN0000012411 TCAAGGTTTGAAACTGACTTT pLKO.1 444 CDS 100% 4.950 3.465 N Vdac2 n/a
12 TRCN0000436478 ACCAAATGACCTTTGACAGTG pLKO_005 626 CDS 100% 4.050 2.835 N Vdac2 n/a
13 TRCN0000012409 GCAGCTAAATACCAGTTGGAT pLKO.1 832 CDS 100% 3.000 2.100 N Vdac2 n/a
14 TRCN0000420966 GACGAAGTCATGCAGCGGTGT pLKO_005 264 CDS 100% 0.720 0.504 N Vdac2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01765 pDONR223 100% 89.1% 94.9% None (many diffs) n/a
2 ccsbBroad304_01765 pLX_304 0% 89.1% 94.9% V5 (many diffs) n/a
3 TRCN0000473187 TTATCACACTCCAAAGTGCATAGA pLX_317 9.2% 89.1% 94.9% V5 (many diffs) n/a
4 ccsbBroadEn_15619 pDONR223 0% 88.9% 93.2% None (many diffs) n/a
5 ccsbBroad304_15619 pLX_304 0% 88.9% 93.2% V5 (many diffs) n/a
6 TRCN0000481484 ATTGATATTTCACTACGCATATTT pLX_317 56.2% 88.9% 93.2% V5 (many diffs) n/a
Download CSV