Construct: ORF TRCN0000473285
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009021.1_s317c1
- Derived from:
- ccsbBroadEn_13369
- DNA Barcode:
- TCTCTCACAGCCAAACTCCAGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZFC3H1 (196441)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473285
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 196441 | ZFC3H1 | zinc finger C3H1-type conta... | NM_144982.5 | 17.6% | 17.1% | (many diffs) |
| 2 | mouse | 216345 | Zfc3h1 | zinc finger, C3H1-type cont... | XM_006513541.3 | 27.5% | 26.7% | (many diffs) |
| 3 | mouse | 216345 | Zfc3h1 | zinc finger, C3H1-type cont... | NM_001033261.2 | 15.6% | 15.2% | (many diffs) |
| 4 | mouse | 216345 | Zfc3h1 | zinc finger, C3H1-type cont... | XM_006513540.3 | 15.6% | 15.1% | (many diffs) |
| 5 | mouse | 216345 | Zfc3h1 | zinc finger, C3H1-type cont... | XM_006513539.3 | 15.5% | 15.1% | (many diffs) |
| 6 | mouse | 216345 | Zfc3h1 | zinc finger, C3H1-type cont... | XM_006513538.3 | 15.5% | 15.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1140
- ORF length:
- 1074
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaccgcagat actccggccc cggcctccag tggcctctcg ccgaaggaag 121 aaggggagct tgaagatggg gaaatcagtg acgacgataa taacagccag atacggagtc 181 ggagcagcag cagcagcagc ggcggcgggc tgttacccta tccgcggcga aggcctcctc 241 actcggcccg gggcggtgga tctggcggag gcggtggctc ttcctcgtca tcgtcctctt 301 ctcagcagca gctgaggaat ttctcacgct cgcggcacgc gtctgagcgg ggccacctca 361 ggggacccag cagctaccga cccaaagaac cgttccggtc tcatccgcct tctgtacgga 421 tgccttcgag ctcactgtcc gaaagcagtc cccggccgtc tttctgggag cggagccacc 481 tcgccttgga ccgtttccgc tttcgaggca ggccttaccg gggtgggagt cgctggagtc 541 gggggcgagg agtgggtgag cgaggaggca agccggggtg cagaccTCCT CTGGGAGGAG 601 GAGCAGGATC CGGGTTCAGC AGCAGTCAGA GCTGGCGAGA GCCCTCTCCA CCTCGGAAGA 661 GCTCCAAAAG TTTTGGAAGG TCTCCATCAA GAAAACAAAA TTATTCATCA AAAAATGAAA 721 ACTGTGTGGA AGAAACTTTT GAAGATTTGC TTTTAAAGTA TAAACAAATA CAGTTGGAAC 781 TAGAATGCAT CAATAAGGAT GAAAAACTAG CATTGAGTAG CAAAGAAGAG AATGTGCAGG 841 AAGATCCTAA AACATTGAAC TTCGAGGACC AAACTAGCAC TGATAATGTC AGTATTACAA 901 AGGATTCAAG TAAAGAAGTA GCTCCTGAGG AGAAAACACA AGTCAAAACT TTTCAGGCAT 961 TTGAATTAAA ACCACTCAGG CAAAAATTGA CTTTACCAGG AGATAAGAAC CGTTTGAAAA 1021 AAGTTAAAGA TGGAGCAAAA CCACTTTCCC TGAAATCCGA CACTACTGAT TCTAGTCAAG 1081 GTATCCCTTA TCGGGTAAAG GAGGGTTTTA CTCCTATTCC TGGTTTGAAA TTTTCAGCGT 1141 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1201 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1261 TTTATATATC TTGTGGAAAG GACGATCTCT CACAGCCAAA CTCCAGTCAA CGCGTTAAGT 1321 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt