Construct: ORF TRCN0000473301
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003548.1_s317c1
- Derived from:
- ccsbBroadEn_03395
- DNA Barcode:
- CGTTATCTTAGAATGTCACTAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IL20RB (53833)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473301
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 53833 | IL20RB | interleukin 20 receptor sub... | NM_144717.4 | 100% | 100% | |
2 | human | 53833 | IL20RB | interleukin 20 receptor sub... | XM_011512910.3 | 91.7% | 89.4% | (many diffs) |
3 | human | 53833 | IL20RB | interleukin 20 receptor sub... | XM_006713665.4 | 84.8% | 84.8% | 0_1ins141 |
4 | human | 53833 | IL20RB | interleukin 20 receptor sub... | XM_011512911.2 | 84.8% | 84.8% | 0_1ins141 |
5 | human | 53833 | IL20RB | interleukin 20 receptor sub... | XM_017006632.1 | 84.8% | 84.8% | 0_1ins141 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 999
- ORF length:
- 933
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gactttcaca atggttctag aagaaatctg gacaagtctt ttcatgtggt 121 ttttctacgc attgattcca tgtttgctca cagatgaagt ggccattctg cctgcccctc 181 agaacctctc tgtactctca accaacatga agcatctctt gatgtggagc ccagtgatcg 241 cgcctggaga aacagtgtac tattctgtcg aataccaggg ggagtacgag agcctgtaca 301 cgagccacat ctggatcccc agcagctggt gctcactcac tgaaggtcct gagtgtgatg 361 tcactgatga catcacggcc actgtgccat acaaccttcg tgtcagggcc acattgggct 421 cacagacctc agcctggagc atcctgaagc atccctttaa tagaaactca accatcctta 481 cccgacctgg gatggagatc accaaagatg gcttccacct ggttattgag ctggaggacc 541 tggggcccca gtttgagttc cttgtggcct actggaggag ggagccTGGT GCCGAGGAAC 601 ATGTCAAAAT GGTGAGGAGT GGGGGTATTC CAGTGCACCT AGAAACCATG GAGCCAGGGG 661 CTGCATACTG TGTGAAGGCC CAGACATTCG TGAAGGCCAT TGGGAGGTAC AGCGCCTTCA 721 GCCAGACAGA ATGTGTGGAG GTGCAAGGAG AGGCCATTCC CCTGGTACTG GCCCTGTTTG 781 CCTTTGTTGG CTTCATGCTG ATCCTTGTGG TCGTGCCACT GTTCGTCTGG AAAATGGGCC 841 GGCTGCTCCA GTACTCCTGT TGCCCCGTGG TGGTCCTCCC AGACACCTTG AAAATAACCA 901 ATTCACCCCA GAAGTTAATC AGCTGCAGAA GGGAGGAGGT GGATGCCTGT GCCACGGCTG 961 TGATGTCTCC TGAGGAACTC CTCAGGGCCT GGATCTCATA CCCAACTTTC TTGTACAAAG 1021 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1081 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1141 ACGACGTTAT CTTAGAATGT CACTAGATAC GCGTTAAGTC gacaatcaac ctctggatta 1201 caaaatttgt gaaagatt