Transcript: Human XM_011512910.3

PREDICTED: Homo sapiens interleukin 20 receptor subunit beta (IL20RB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL20RB (53833)
Length:
1952
CDS:
140..1090

Additional Resources:

NCBI RefSeq record:
XM_011512910.3
NBCI Gene record:
IL20RB (53833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512910.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148759 CGCATTGATTCCATGTTTGCT pLKO.1 45 5UTR 100% 3.000 2.400 N IL20RB n/a
2 TRCN0000146797 CAGTGTACTATTCTGTCGAAT pLKO.1 342 CDS 100% 4.950 3.465 N IL20RB n/a
3 TRCN0000146699 CCAGAATAATCCTTGAGAGAA pLKO.1 1600 3UTR 100% 4.950 3.465 N IL20RB n/a
4 TRCN0000148325 CTCTGTACTCTCAACCAACAT pLKO.1 277 CDS 100% 4.950 3.465 N IL20RB n/a
5 TRCN0000149761 GCAATGGTGTTGAGTTCACTT pLKO.1 1635 3UTR 100% 4.950 3.465 N IL20RB n/a
6 TRCN0000148408 CCCAGAATAATCCTTGAGAGA pLKO.1 1599 3UTR 100% 2.640 1.848 N IL20RB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512910.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03395 pDONR223 100% 91.7% 89.4% None (many diffs) n/a
2 ccsbBroad304_03395 pLX_304 0% 91.7% 89.4% V5 (many diffs) n/a
3 TRCN0000473301 CGTTATCTTAGAATGTCACTAGAT pLX_317 44.3% 91.7% 89.4% V5 (many diffs) n/a
4 TRCN0000487749 GAACACGTGAAATTCCCTACACAA pLX_317 23.3% 91.7% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488207 AACCTCTAGTATGCGATATCCTCG pLX_317 30.6% 91.6% 89.1% V5 (many diffs) n/a
6 ccsbBroadEn_12024 pDONR223 100% 53.4% 53.4% None 1_441del n/a
7 ccsbBroad304_12024 pLX_304 0% 53.4% 53.4% V5 1_441del n/a
8 TRCN0000475400 CCGAGTGGCTCTACGTGCTAGACC pLX_317 75.3% 53.4% 53.4% V5 1_441del n/a
9 ccsbBroadEn_12025 pDONR223 100% 46.5% 42.7% None 1_156del;545_695del;749_948del n/a
10 ccsbBroad304_12025 pLX_304 0% 46.5% 42.7% V5 1_156del;545_695del;749_948del n/a
11 TRCN0000471047 TCAATTAGTCTTACGAATAATTAC pLX_317 74.4% 46.5% 42.7% V5 1_156del;545_695del;749_948del n/a
Download CSV