Transcript: Human XM_017006632.1

PREDICTED: Homo sapiens interleukin 20 receptor subunit beta (IL20RB), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL20RB (53833)
Length:
1860
CDS:
204..998

Additional Resources:

NCBI RefSeq record:
XM_017006632.1
NBCI Gene record:
IL20RB (53833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146797 CAGTGTACTATTCTGTCGAAT pLKO.1 250 CDS 100% 4.950 3.465 N IL20RB n/a
2 TRCN0000146699 CCAGAATAATCCTTGAGAGAA pLKO.1 1508 3UTR 100% 4.950 3.465 N IL20RB n/a
3 TRCN0000148325 CTCTGTACTCTCAACCAACAT pLKO.1 185 5UTR 100% 4.950 3.465 N IL20RB n/a
4 TRCN0000149761 GCAATGGTGTTGAGTTCACTT pLKO.1 1543 3UTR 100% 4.950 3.465 N IL20RB n/a
5 TRCN0000148408 CCCAGAATAATCCTTGAGAGA pLKO.1 1507 3UTR 100% 2.640 1.848 N IL20RB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03395 pDONR223 100% 84.8% 84.8% None 0_1ins141 n/a
2 ccsbBroad304_03395 pLX_304 0% 84.8% 84.8% V5 0_1ins141 n/a
3 TRCN0000473301 CGTTATCTTAGAATGTCACTAGAT pLX_317 44.3% 84.8% 84.8% V5 0_1ins141 n/a
4 TRCN0000487749 GAACACGTGAAATTCCCTACACAA pLX_317 23.3% 84.8% 84.8% V5 (not translated due to prior stop codon) 0_1ins141 n/a
5 TRCN0000488207 AACCTCTAGTATGCGATATCCTCG pLX_317 30.6% 84.7% 84.6% V5 0_1ins141;792_793insG n/a
6 ccsbBroadEn_12024 pDONR223 100% 64% 64% None 1_285del n/a
7 ccsbBroad304_12024 pLX_304 0% 64% 64% V5 1_285del n/a
8 TRCN0000475400 CCGAGTGGCTCTACGTGCTAGACC pLX_317 75.3% 64% 64% V5 1_285del n/a
9 ccsbBroadEn_12025 pDONR223 100% 55.6% 51.1% None 389_539del;593_792del n/a
10 ccsbBroad304_12025 pLX_304 0% 55.6% 51.1% V5 389_539del;593_792del n/a
11 TRCN0000471047 TCAATTAGTCTTACGAATAATTAC pLX_317 74.4% 55.6% 51.1% V5 389_539del;593_792del n/a
Download CSV