Construct: ORF TRCN0000473332
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009427.1_s317c1
- Derived from:
- ccsbBroadEn_01050
- DNA Barcode:
- TGACTATTTCTACATTCCTGGACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MUC1 (4582)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473332
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001018016.3 | 100% | 100% | |
2 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001018017.3 | 96.5% | 96.5% | 54_55ins27 |
3 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204287.2 | 93.6% | 93.6% | 187_240del |
4 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204291.1 | 91.2% | 91.2% | 186_187ins69 |
5 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204292.1 | 90.5% | 85.9% | 186_187insTTTAATTCCTCTCTGGAAG;235_236ins56 |
6 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_002456.6 | 90.4% | 90.4% | 54_55ins27;160_213del |
7 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204289.2 | 90.1% | 90.1% | 186_187ins78 |
8 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204294.2 | 87.1% | 82.5% | 54_55ins27;159_160insTTTAATTCCTCTCTGGAAG;208_209ins56 |
9 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204288.2 | 82.9% | 59.9% | 447_448ins32;657_658ins103 |
10 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204290.2 | 82.1% | 82.1% | 55_56ins63;123_124ins78 |
11 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204296.2 | 80.3% | 69.3% | 186_187insTTTAATTCCTCTCTGGAAG;291_292ins137 |
12 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001044390.3 | 76.8% | 65.9% | 54_55ins27;159_160insTTTAATTCCTCTCTGGAAG;264_265ins137 |
13 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204295.1 | 71.5% | 71.5% | 254_255ins225 |
14 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204293.2 | 63.8% | 48.9% | (many diffs) |
15 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001044392.3 | 60.2% | 60.2% | 253_254ins315 |
16 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001044393.3 | 59.8% | 25.8% | (many diffs) |
17 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001044391.3 | 56.8% | 56.8% | 54_55ins27;226_227ins315 |
18 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204297.2 | 56.3% | 56.3% | 187_240del;307_308ins315 |
19 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204286.1 | 54.5% | 54.5% | 187_846del |
20 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204285.2 | 52.6% | 52.6% | 54_55ins27;160_819del |
21 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001371720.1 | 19.8% | 17.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 861
- ORF length:
- 792
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacaccgggc acccagtctc ctttcttcct gctgctgctc ctcacagtgc 121 ttacagctac cacagcccct aaacccgcaa cagttgttac gggttctggt catgcaagct 181 ctaccccagg tggagaaaag gagacttcgg ctacccagag aagttcagtg cccagctcta 241 ctgagaagaa tgcttttaat tcctctctgg aagatcccag caccgactac taccaagagc 301 tgcagagaga catttctgaa atgtttttgc agatttataa acaagggggt tttctgggcc 361 tctccaatat taagttcagg ccaggatctg tggtggtaca attgactctg gccttccgag 421 aaggtaccat caatgtccac gacgtggaga cacagttcaa tcagtataaa acggaagcag 481 cctctcgata taaCCTGACG ATCTCAGACG TCAGCGTGAG TGATGTGCCA TTTCCTTTCT 541 CTGCCCAGTC TGGGGCTGGG GTGCCAGGCT GGGGCATCGC GCTGCTGGTG CTGGTCTGTG 601 TTCTGGTTGC GCTGGCCATT GTCTATCTCA TTGCCTTGGC TGTCTGTCAG TGCCGCCGAA 661 AGAACTACGG GCAGCTGGAC ATCTTTCCAG CCCGGGATAC CTACCATCCT ATGAGCGAGT 721 ACCCCACCTA CCACACCCAT GGGCGCTATG TGCCCCCTAG CAGTACCGAT CGTAGCCCCT 781 ATGAGAAGGT TTCTGCAGGT AATGGTGGCA GCAGCCTCTC TTACACAAAC CCAGCAGTGG 841 CAGCCACTTC TGCCAACTTG TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 901 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 961 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATGAC TATTTCTACA 1021 TTCCTGGACA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt