Transcript: Human NM_001204286.1

Homo sapiens mucin 1, cell surface associated (MUC1), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
MUC1 (4582)
Length:
1853
CDS:
73..1527

Additional Resources:

NCBI RefSeq record:
NM_001204286.1
NBCI Gene record:
MUC1 (4582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122935 CTCTCGATATAACCTGACGAT pLKO.1 1146 CDS 100% 2.640 3.696 N MUC1 n/a
2 TRCN0000430218 AGGATCTGTGGTGGTACAATT pLKO_005 1047 CDS 100% 13.200 9.240 N MUC1 n/a
3 TRCN0000122938 GACACAGTTCAATCAGTATAA pLKO.1 1113 CDS 100% 13.200 9.240 N MUC1 n/a
4 TRCN0000122934 CCACCAATTTCTCGGACACTT pLKO.1 1669 3UTR 100% 4.950 3.465 N MUC1 n/a
5 TRCN0000122937 CCGGGATACCTACCATCCTAT pLKO.1 1356 CDS 100% 4.950 3.465 N MUC1 n/a
6 TRCN0000122936 CCAGTTTAATTCCTCTCTGGA pLKO.1 915 CDS 100% 2.640 1.848 N MUC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01050 pDONR223 100% 54.5% 54.5% None 187_846del n/a
2 ccsbBroad304_01050 pLX_304 0% 54.5% 54.5% V5 187_846del n/a
3 TRCN0000473332 TGACTATTTCTACATTCCTGGACA pLX_317 46.3% 54.5% 54.5% V5 187_846del n/a
4 ccsbBroadEn_06603 pDONR223 100% 52.6% 52.6% None 55_81del;93G>A;187_846del n/a
5 ccsbBroad304_06603 pLX_304 0% 52.6% 52.6% V5 55_81del;93G>A;187_846del n/a
6 TRCN0000480546 CATAATTTAAATACTTACTCAGTT pLX_317 46.7% 52.6% 52.6% V5 55_81del;93G>A;187_846del n/a
Download CSV