Transcript: Human NM_001044393.3

Homo sapiens mucin 1, cell surface associated (MUC1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
MUC1 (4582)
Length:
957
CDS:
67..543

Additional Resources:

NCBI RefSeq record:
NM_001044393.3
NBCI Gene record:
MUC1 (4582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001044393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413438 CACAGTGCTTACAGTTGTTAC pLKO_005 111 CDS 100% 10.800 7.560 N MUC1 n/a
2 TRCN0000122934 CCACCAATTTCTCGGACACTT pLKO.1 788 3UTR 100% 4.950 3.465 N MUC1 n/a
3 TRCN0000122937 CCGGGATACCTACCATCCTAT pLKO.1 475 CDS 100% 4.950 3.465 N MUC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001044393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06603 pDONR223 100% 61.8% 26.7% None (many diffs) n/a
2 ccsbBroad304_06603 pLX_304 0% 61.8% 26.7% V5 (many diffs) n/a
3 TRCN0000480546 CATAATTTAAATACTTACTCAGTT pLX_317 46.7% 61.8% 26.7% V5 (many diffs) n/a
4 ccsbBroadEn_01050 pDONR223 100% 59.8% 25.8% None (many diffs) n/a
5 ccsbBroad304_01050 pLX_304 0% 59.8% 25.8% V5 (many diffs) n/a
6 TRCN0000473332 TGACTATTTCTACATTCCTGGACA pLX_317 46.3% 59.8% 25.8% V5 (many diffs) n/a
Download CSV