Construct: ORF TRCN0000473358
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005182.1_s317c1
- Derived from:
- ccsbBroadEn_11215
- DNA Barcode:
- GACTAAATGTCATTATTAATAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VASP (7408)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473358
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7408 | VASP | vasodilator stimulated phos... | XM_005259199.2 | 99.7% | 99.4% | 3_4insAGC |
| 2 | human | 7408 | VASP | vasodilator stimulated phos... | NM_003370.4 | 99.4% | 99.2% | 3_4insAGC;719_721delAGC |
| 3 | human | 7408 | VASP | vasodilator stimulated phos... | XM_017027200.2 | 99.4% | 99.2% | 3_4insAGC;870_871insCAG |
| 4 | human | 7408 | VASP | vasodilator stimulated phos... | XM_005259200.2 | 99.2% | 98.9% | 3_4insAGC;719_721delAGC;873_874insCAG |
| 5 | mouse | 22323 | Vasp | vasodilator-stimulated phos... | NM_001282021.1 | 86% | 87.1% | (many diffs) |
| 6 | mouse | 22323 | Vasp | vasodilator-stimulated phos... | NM_009499.3 | 85.8% | 86.8% | (many diffs) |
| 7 | mouse | 22323 | Vasp | vasodilator-stimulated phos... | NM_001282022.1 | 83.5% | 84.5% | (many diffs) |
| 8 | mouse | 22323 | Vasp | vasodilator-stimulated phos... | NR_104069.1 | 26.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1206
- ORF length:
- 1140
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cagcgagacg gtcatctgtt ccagccgggc cactgtgatg ctttatgatg 121 atggcaacaa gcgatggctc cctgctggca cgggtcccca ggccttcagc cgcgtccaga 181 tctaccacaa ccccacggcc aattcctttc gcgtcgtggg ccggaagatg cagcccgacc 241 agcaggtggt catcaactgt gccatcgtcc ggggtgtcaa gtataaccag gccaccccca 301 acttccatca gtggcgcgac gctcgccagg tctggggcct caacttcggc agcaaggagg 361 atgcggccca gtttgccgcc ggcatggcca gtgccctaga ggcgttggaa ggaggtgggc 421 cccctccacc cccagcactt cccacctggt cggtcccgaa cggcccctcc ccggaggagg 481 tggagcagca gaaaaggcag cagcccggcc cgtcggagca catagagcgc cgggtctcca 541 atgcaggagg cccacctgct ccccccgctg ggggtccacc cccaccacca ggacctcccc 601 ctcctccagg tcccccccca cccccaggtt tgcccccttc gggggtccca gctgcagcgc 661 acggagcagg gggaggacca ccccctgcac cccctctccc ggcagcacag ggccctggtg 721 gtgggggagc tggggcccca ggcctggccg cagctattgc tggagccaaa ctcaggaaag 781 tcagcaagga ggaggccTCA GGGGGGCCCA CAGCCCCCAA AGCTGAGAGT GGTCGAAGCG 841 GAGGTGGGGG ACTCATGGAA GAGATGAACG CCATGCTGGC CCGGAGAAGG AAAGCCACGC 901 AAGTTGGGGA GAAAACCCCC AAGGATGAAT CTGCCAATCA GGAGGAGCCA GAGGCCAGAG 961 TCCCGGCCCA GAGTGAATCT GTGCGGAGAC CCTGGGAGAA GAACAGCACA ACCTTGCCAA 1021 GGATGAAGTC GTCTTCTTCG GTGACCACTT CCGAGACCCA ACCCTGCACG CCCAGCTCCA 1081 GTGATTACTC GGACCTACAG AGGGTGAAAC AGGAGCTTCT GGAAGAGGTG AAGAAGGAAT 1141 TGCAGAAAGT GAAAGAGGAA ATCATTGAAG CCTTCGTCCA GGAGCTGAGG AAGCGGGGTT 1201 CTCCCTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1261 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1321 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGACTAAATG TCATTATTAA TAAATACGCG 1381 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt