Construct: ORF TRCN0000473395
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005715.1_s317c1
- Derived from:
- ccsbBroadEn_12283
- DNA Barcode:
- TATTACCGGGCCGTATTAGTTGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TEX2 (55852)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473395
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55852 | TEX2 | testis expressed 2 | NM_001288732.2 | 24.5% | 24.5% | 1_2550del |
| 2 | human | 55852 | TEX2 | testis expressed 2 | NM_001288733.2 | 24.5% | 24.5% | 1_2550del |
| 3 | human | 55852 | TEX2 | testis expressed 2 | NM_018469.5 | 24.4% | 24.4% | 1_2571del |
| 4 | human | 55852 | TEX2 | testis expressed 2 | XM_011524998.1 | 24.4% | 24.4% | 1_2571del |
| 5 | human | 55852 | TEX2 | testis expressed 2 | XM_011524999.1 | 24.4% | 24.4% | 1_2571del |
| 6 | human | 55852 | TEX2 | testis expressed 2 | XM_017024846.2 | 24.4% | 24.4% | 1_2550del;2803_2804insGTTGCA |
| 7 | human | 55852 | TEX2 | testis expressed 2 | XM_011525000.2 | 24.2% | 24.2% | 1_2571del;2824_2825insGTTGCA |
| 8 | mouse | 21763 | Tex2 | testis expressed gene 2 | NM_198292.3 | 22.3% | 23.3% | (many diffs) |
| 9 | mouse | 21763 | Tex2 | testis expressed gene 2 | XM_006533143.3 | 22.3% | 23.3% | (many diffs) |
| 10 | mouse | 21763 | Tex2 | testis expressed gene 2 | XM_006533144.3 | 22.3% | 23.3% | (many diffs) |
| 11 | mouse | 21763 | Tex2 | testis expressed gene 2 | XM_006533145.1 | 22.3% | 23.3% | (many diffs) |
| 12 | mouse | 21763 | Tex2 | testis expressed gene 2 | XM_006533146.3 | 22.3% | 23.3% | (many diffs) |
| 13 | mouse | 21763 | Tex2 | testis expressed gene 2 | XM_006533147.3 | 22.3% | 23.3% | (many diffs) |
| 14 | mouse | 21763 | Tex2 | testis expressed gene 2 | XM_006533148.3 | 22.1% | 23.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 897
- ORF length:
- 831
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa actcagcaaa ataaagctcc cctactttat gaatgagctc actctgacgg 121 aacttgacat gggcgtggct gtgccaaaaa tcctccaggc cttcaagcct tacgttgatc 181 accaaggact ctggattgat ttggaaatgt cctacaatgg gtcctttctg atgactctcg 241 agaccaaaat gaatttgacc aaactaggta aagagcctct tgttgaagcc ctgaaggttg 301 gagaaattgg caaagaaggt tgcaggcccc gggcattctg tctggcggac agcgatgagg 361 aatcctccag cgctggctcc tccgaggaag acgatgcccc agagcccagc gggggagaca 421 aacagctcct cccaggggct gaagggtacg ttggaggtca tcgaacaagt aagattatga 481 ggtttgttga taaaattacc aagtcaaaat atttccaaaa agcaacagag acagagttta 541 ttaaaaagaa gatcgaagaa gtctccaaca cacccctgct gctcactgtt gaagtacaag 601 aatgtagagg aaccttggcg gtcaacattc caccaccccc gactgaccga gtatggtatg 661 gtttccgaaa gccaccacat gtggagctga aagctcggcc aaaacttgga gagagagaag 721 tgactttagt tcatgtgaca gactggatag agaagaaact ggagcaagag tttcagaaag 781 tttttgtcat gccaaacatg gatgatgttt atatcactat aatgcactca gccatggacc 841 ctcgctcTAC TTCCTGCCTC CTGAAAGACC CACCTGTGGA GGCTGCTGAT CAGCCATGCC 901 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 961 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1021 ATATATCTTG TGGAAAGGAC GATATTACCG GGCCGTATTA GTTGAAACGC GTTAAGTCga 1081 caatcaacct ctggattaca aaatttgtga aagatt