Transcript: Mouse XM_006533146.3

PREDICTED: Mus musculus testis expressed gene 2 (Tex2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tex2 (21763)
Length:
4854
CDS:
208..3594

Additional Resources:

NCBI RefSeq record:
XM_006533146.3
NBCI Gene record:
Tex2 (21763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533146.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250179 GACATCAAGGAGCCCGAAATA pLKO_005 1819 CDS 100% 13.200 10.560 N Tex2 n/a
2 TRCN0000216012 CAAACATGGATGACGTTTATA pLKO.1 3488 CDS 100% 15.000 10.500 N Tex2 n/a
3 TRCN0000250182 CAAACATGGATGACGTTTATA pLKO_005 3488 CDS 100% 15.000 10.500 N Tex2 n/a
4 TRCN0000189793 GCACCAGGAGTTACCTGTAAA pLKO.1 1602 CDS 100% 13.200 9.240 N Tex2 n/a
5 TRCN0000250181 GGGACTTCTTGGGCGAGAAAT pLKO_005 2708 CDS 100% 13.200 9.240 N Tex2 n/a
6 TRCN0000250178 ACTTGACCAAACTAGGTAAAG pLKO_005 2948 CDS 100% 10.800 7.560 N Tex2 n/a
7 TRCN0000250180 CCATCCCAAAGACGTACAATC pLKO_005 4250 3UTR 100% 10.800 7.560 N Tex2 n/a
8 TRCN0000200476 CGATTTGGAAATGTCTTACAA pLKO.1 2892 CDS 100% 5.625 3.938 N Tex2 n/a
9 TRCN0000191613 GCAAGATTTATCTTGTACCTA pLKO.1 2042 CDS 100% 0.300 0.180 N Tex2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533146.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12283 pDONR223 100% 22.3% 23.3% None (many diffs) n/a
2 ccsbBroad304_12283 pLX_304 0% 22.3% 23.3% V5 (many diffs) n/a
3 TRCN0000473395 TATTACCGGGCCGTATTAGTTGAA pLX_317 7% 22.3% 23.3% V5 (many diffs) n/a
Download CSV