Construct: ORF TRCN0000473448
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000988.1_s317c1
- Derived from:
- ccsbBroadEn_00314
- DNA Barcode:
- TAGCCCCGACCAGACGGTTAACAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CKMT1B (1159)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473448
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NM_020990.4 | 100% | 100% | |
| 2 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521197.2 | 100% | 100% | |
| 3 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001015001.2 | 99.8% | 100% | 1056G>A;1086C>T |
| 4 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321926.1 | 99.8% | 100% | 1056G>A;1086C>T |
| 5 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521194.1 | 93% | 93% | 148_240del |
| 6 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521195.2 | 93% | 93% | 148_240del |
| 7 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521196.1 | 93% | 93% | 148_240del |
| 8 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321927.1 | 92.9% | 93% | 148_240del;1149G>A;1179C>T |
| 9 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321928.1 | 92.9% | 93% | 148_240del;1149G>A;1179C>T |
| 10 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_017022369.1 | 92.9% | 93% | 148_240del;1149G>A;1179C>T |
| 11 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_017022370.1 | 92.9% | 93% | 148_240del;1149G>A;1179C>T |
| 12 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521198.1 | 88.9% | 88.7% | (many diffs) |
| 13 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_005254150.4 | 61.8% | 60.9% | 0_1ins433;11_12ins44 |
| 14 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521199.2 | 61.8% | 60.9% | 0_1ins433;11_12ins44 |
| 15 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_017021902.1 | 61.8% | 60.9% | 0_1ins433;11_12ins44 |
| 16 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321929.1 | 61.7% | 60.9% | (many diffs) |
| 17 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_005254498.4 | 61.7% | 60.9% | (many diffs) |
| 18 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NR_135856.1 | 59.4% | (many diffs) | |
| 19 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135751.1 | 46.3% | (many diffs) | |
| 20 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135750.1 | 44.5% | 1_589del;1464_2280del;2658_2809del | |
| 21 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135748.1 | 43.7% | (many diffs) | |
| 22 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135749.1 | 41.8% | (many diffs) | |
| 23 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_017022371.1 | 41.2% | 34.5% | 148_240del;537_538ins44;648_649ins652 |
| 24 | mouse | 12716 | Ckmt1 | creatine kinase, mitochondr... | NM_001355069.1 | 92.1% | 96.6% | (many diffs) |
| 25 | mouse | 12716 | Ckmt1 | creatine kinase, mitochondr... | NM_009897.3 | 92.1% | 96.6% | (many diffs) |
| 26 | mouse | 12716 | Ckmt1 | creatine kinase, mitochondr... | XM_006498656.3 | 92.1% | 96.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1320
- ORF length:
- 1251
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctggtccc ttctcccgtc tgctgtccgc ccgcccggga ctcaggctcc 121 tggctttggc cggagcgggg tctctagccg ctgggtttct gctccgaccg gaacctgtac 181 gagctgccag tgaacgacgg aggctgtatc ccccgagcgc tgagtaccca gacctccgaa 241 agcacaacaa ctgcatggcc agtcacctga ccccagcagt ctatgcacgg ctctgcgaca 301 agaccacacc cactggttgg acgctagatc agtgtatcca gactggcgtg gacaaccctg 361 gccacccctt catcaagact gtgggcatgg tggctggaga tgaggagacc tatgaggtat 421 ttgctgacct gtttgaccct gtgatccaag agcgacacaa tggatatgac ccccggacaa 481 tgaagcacac cacggatcta gatgccagta aaatccgttc tggctacttt gatgagaggt 541 atgtattgtc ctctagagtc agaactggcc gaagcatccg aggactcagt ctgcctccag 601 cttgcactcg agcagagcga cgagaggtgg aacgtgttgt ggtggatgca ctgagtggcc 661 tgaagggtga cctggctgga cgttactata ggctcagtga gatgacagag gctgaacagc 721 agcagcttat tgatgaccac tttctgtttg ataagcctgt gtccccgttg ctgactgcag 781 caggaatggc tcgagactgg ccagatgctc gtggaatttg gcacaacaat gagaagagct 841 tccTGATCTG GGTGAATGAG GAGGATCATA CACGGGTGAT CTCCATGGAG AAGGGTGGTA 901 ACATGAAGAG AGTGTTTGAA AGATTCTGCC GAGGCCTCAA AGAGGTGGAG AGACTTATCC 961 AAGAACGTGG CTGGGAGTTC ATGTGGAATG AGCGTTTGGG ATACATCTTG ACCTGTCCAT 1021 CTAACCTGGG CACTGGACTT CGGGCAGGAG TGCACATCAA ACTGCCCCTG CTAAGCAAAG 1081 ATAGCCGCTT CCCAAAGATC CTGGAGAACC TAAGACTCCA AAAACGTGGT ACTGGAGGAG 1141 TGGACACTGC TGCTACAGGC GGTGTCTTTG ATATTTCTAA TTTGGACCGA CTAGGCAAAT 1201 CAGAGGTGGA GCTGGTGCAA CTGGTCATCG ATGGAGTAAA CTATTTGATT GATTGTGAAC 1261 GGCGTCTGGA GAGAGGCCAG GATATCCGCA TCCCCACACC TGTCATCCAC ACCAAGCATT 1321 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1381 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1441 TTTATATATC TTGTGGAAAG GACGATAGCC CCGACCAGAC GGTTAACACA CGCGTTAAGT 1501 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt