Construct: ORF TRCN0000473468
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000973.1_s317c1
- Derived from:
- ccsbBroadEn_11940
- DNA Barcode:
- TAGCGCTCCGCATCATCGACTTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TXNDC11 (51061)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473468
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51061 | TXNDC11 | thioredoxin domain containi... | NM_001324024.2 | 65.2% | 65.2% | 1_528del |
| 2 | human | 51061 | TXNDC11 | thioredoxin domain containi... | NM_001324025.2 | 65.2% | 65.2% | 1_528del |
| 3 | human | 51061 | TXNDC11 | thioredoxin domain containi... | NR_136674.2 | 47.4% | (many diffs) | |
| 4 | human | 51061 | TXNDC11 | thioredoxin domain containi... | NR_136673.2 | 45% | (many diffs) | |
| 5 | human | 51061 | TXNDC11 | thioredoxin domain containi... | NR_136672.2 | 44.6% | (many diffs) | |
| 6 | human | 51061 | TXNDC11 | thioredoxin domain containi... | NM_001324022.2 | 44.3% | 44.3% | 1_1242del |
| 7 | human | 51061 | TXNDC11 | thioredoxin domain containi... | NR_136671.2 | 42.4% | (many diffs) | |
| 8 | human | 51061 | TXNDC11 | thioredoxin domain containi... | XM_011522516.3 | 42% | 42% | 1_1362del |
| 9 | human | 51061 | TXNDC11 | thioredoxin domain containi... | NM_015914.7 | 34.4% | 34.4% | 1_1884del |
| 10 | human | 51061 | TXNDC11 | thioredoxin domain containi... | NM_001303447.2 | 33.5% | 33.5% | 1_1965del |
| 11 | human | 51061 | TXNDC11 | thioredoxin domain containi... | XM_017023268.1 | 33% | 33% | 1_2001del |
| 12 | human | 51061 | TXNDC11 | thioredoxin domain containi... | XM_011522515.2 | 33% | 33% | 1_2004del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1056
- ORF length:
- 990
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gctcacccta gagtctttta ttcaaaactt cagcgttctc tatagtccct 121 tgaaaaggca tctcattgga agtggctctg cccagttccc gtctcagcat ttaatcactg 181 aagtgacaac tgataccttt tgggaagtag tccttcaaaa acaggacgtt ctcctgctct 241 attacgctcc gtggtgcggc ttctgtccat ccctcaatca catcttcatc cagctagctc 301 ggaacctgcc catggacaca ttcactgtgg caaggattga cgtgtctcag aatgaccttc 361 cttgggaatt tatggtcgat cgtcttccta ctgtcttgtt ttttccctgc aacagaaagg 421 acctaagtgt gaaatacccc gaagacgtcc ccatcaccct tccaaacctg ttgaggttca 481 ttttgcatca ctcagaccct gcttccagcc cccagaatgt ggctaactct cctaccaagg 541 agtgtcttca gagcgaggca gtcttacagc gggggcacat ctcccacttg gagagagaga 601 tccagaaact gagagcagaa ataagcagcc tccagcgagc acaagtgcag gtggagtccc 661 agctctccag tgcccgcaga gatgagcacc ggctgcggCA GCAGCAGCGG GCCCTGGAAG 721 AGCAGCACAG CCTGCTCCAC GCACACAGTG AGCAGCTGCA GGCCCTCTAT GAGCAGAAGA 781 CACGTGAGCT GCAGGAGCTG GCCCGCAAGC TGCAGGAGCT GGCCGATGCC TCAGAAAACC 841 TCCTTACCGA GAACACGTGG CTCAAGATCC TGGTGGCGAC CATGGAGAGG AAACTGGAGG 901 GCAGGGATGG AGCTGAAAGC CTGGCGGCCC AGAGAGAGGT CCACCCCAAG CAGCCTGAGC 961 CCTCAGCCAC CCCCCAGCTC CCTGGCAGCT CCCCTCCACC TGCCAATGTC AGCGCCACAC 1021 TGGTGTCTGA AAGGAATAAG GAGAACAGGA CAGACTACCC AACATTCTTG TACAAAGTGG 1081 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1141 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1201 ATAGCGCTCC GCATCATCGA CTTGCACGCG TTAAGTCgac aatcaacctc tggattacaa 1261 aatttgtgaa agatt