Transcript: Human NM_001324025.2

Homo sapiens thioredoxin domain containing 11 (TXNDC11), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TXNDC11 (51061)
Length:
2873
CDS:
1241..2761

Additional Resources:

NCBI RefSeq record:
NM_001324025.2
NBCI Gene record:
TXNDC11 (51061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129550 CGATCGTCTTCCTACTGTCTT pLKO.1 2080 CDS 100% 4.950 6.930 N TXNDC11 n/a
2 TRCN0000336726 CGATCGTCTTCCTACTGTCTT pLKO_005 2080 CDS 100% 4.950 6.930 N TXNDC11 n/a
3 TRCN0000128065 CTGGATTATGCAGAGTACGTT pLKO.1 470 5UTR 100% 3.000 4.200 N TXNDC11 n/a
4 TRCN0000128571 GCCGAAAGTCATCCTTTAATA pLKO.1 965 5UTR 100% 15.000 10.500 N TXNDC11 n/a
5 TRCN0000336725 GCCGAAAGTCATCCTTTAATA pLKO_005 965 5UTR 100% 15.000 10.500 N TXNDC11 n/a
6 TRCN0000336805 GACGTTCTCCTGCTCTATTAC pLKO_005 1928 CDS 100% 13.200 9.240 N TXNDC11 n/a
7 TRCN0000130589 CCAAACCTGTTGAGGTTCATT pLKO.1 2165 CDS 100% 0.563 0.394 N TXNDC11 n/a
8 TRCN0000336727 CCAAACCTGTTGAGGTTCATT pLKO_005 2165 CDS 100% 0.563 0.394 N TXNDC11 n/a
9 TRCN0000131001 CCTGAACTACACAGCTGAGAA pLKO.1 808 5UTR 100% 4.950 2.970 N TXNDC11 n/a
10 TRCN0000336724 CCTGAACTACACAGCTGAGAA pLKO_005 808 5UTR 100% 4.950 2.970 N TXNDC11 n/a
11 TRCN0000130023 GAGAAGAAATGTGAGGTTGAT pLKO.1 1496 CDS 100% 4.950 2.970 N TXNDC11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11940 pDONR223 100% 65.2% 65.2% None 1_528del n/a
2 ccsbBroad304_11940 pLX_304 0% 65.2% 65.2% V5 1_528del n/a
3 TRCN0000473468 TAGCGCTCCGCATCATCGACTTGC pLX_317 36.4% 65.2% 65.2% V5 1_528del n/a
Download CSV