Construct: ORF TRCN0000473472
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009529.1_s317c1
- Derived from:
- ccsbBroadEn_03194
- DNA Barcode:
- CCCCGACGCTCTTGTGTCTGCTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMX2 (51075)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473472
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51075 | TMX2 | thioredoxin related transme... | NM_015959.4 | 100% | 100% | |
| 2 | human | 51075 | TMX2 | thioredoxin related transme... | NM_001347890.1 | 97.6% | 97.6% | 614_634del |
| 3 | human | 51075 | TMX2 | thioredoxin related transme... | NM_001144012.2 | 87.1% | 86.8% | 250_251ins114 |
| 4 | human | 51075 | TMX2 | thioredoxin related transme... | NM_001347891.1 | 83.7% | 81.8% | (many diffs) |
| 5 | human | 51075 | TMX2 | thioredoxin related transme... | NM_001347898.1 | 78% | 69.7% | 603_604insGTTAGTACGCG;693_694ins184 |
| 6 | human | 51075 | TMX2 | thioredoxin related transme... | NM_001347892.1 | 76.6% | 76.6% | 0_1ins207 |
| 7 | human | 51075 | TMX2 | thioredoxin related transme... | NM_001347894.1 | 68.2% | 68.2% | 0_1ins282 |
| 8 | human | 51075 | TMX2 | thioredoxin related transme... | NM_001347895.1 | 68.2% | 68.2% | 0_1ins282 |
| 9 | human | 51075 | TMX2 | thioredoxin related transme... | NM_001347896.1 | 68.2% | 68.2% | 0_1ins282 |
| 10 | human | 51075 | TMX2 | thioredoxin related transme... | NM_001347893.1 | 66.6% | 66.6% | 0_1ins282;332_352del |
| 11 | human | 51075 | TMX2 | thioredoxin related transme... | NR_144934.1 | 48.9% | (many diffs) | |
| 12 | human | 51075 | TMX2 | thioredoxin related transme... | NR_144933.1 | 47.2% | 1_96del;460_461ins77;908_1638del | |
| 13 | human | 51075 | TMX2 | thioredoxin related transme... | NR_144935.1 | 45.2% | (many diffs) | |
| 14 | human | 51075 | TMX2 | thioredoxin related transme... | NR_037645.1 | 40% | 1_96del;346_347ins191;794_1550del | |
| 15 | mouse | 66958 | Tmx2 | thioredoxin-related transme... | NM_025868.4 | 87.1% | 92.5% | (many diffs) |
| 16 | mouse | 66958 | Tmx2 | thioredoxin-related transme... | NM_001290751.1 | 75.8% | 80.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 954
- ORF length:
- 888
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggtcttggca cctctaattg ctctcgtgta ttcggtgccg cgactttcac 121 gatggctcgc ccaaccttac taccttctgt cggccctgct ctctgctgcc ttcctactcg 181 tgaggaaact gccgccgctc tgccacggtc tgcccaccca acgcgaagac ggtaacccgt 241 gtgactttga ctggagagaa gtggagatcc tgatgtttct cagtgccatt gtgatgatga 301 agaaccgcag atccatcact gtggagcaac atataggcaa cattttcatg tttagtaaag 361 tggccaacac aattcttttc ttccgcttgg atattcgcat gggcctactt tacatcacac 421 tctgcatagt gttcctgatg acgtgcaaac cccccctata tatgggccct gagtatatca 481 agtacttcaa tgataaaacc attgatgagg aactagaacg ggacaagagg gtcacttgga 541 ttgtggagtt ctttgccaat tggtctaatg actgccaatc atttgcccct atcTATGCTG 601 ACCTCTCCCT TAAATACAAC TGTACAGGGC TAAATTTTGG GAAGGTGGAT GTTGGACGCT 661 ATACTGATGT TAGTACGCGG TACAAAGTGA GCACATCACC CCTCACCAAG CAACTCCCTA 721 CCCTGATCCT GTTCCAAGGT GGCAAGGAGG CAATGCGGCG GCCACAGATT GACAAGAAAG 781 GACGGGCTGT CTCATGGACC TTCTCTGAGG AGAATGTGAT CCGAGAATTT AACTTAAATG 841 AGCTATACCA GCGGGCCAAG AAACTATCAA AGGCTGGAGA CAATATCCCT GAGGAGCAGC 901 CTGTGGCTTC AACCCCCACC ACAGTGTCAG ATGGGGAAAA CAAGAAGGAT AAATACCCAA 961 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1021 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1081 TATCTTGTGG AAAGGACGAC CCCGACGCTC TTGTGTCTGC TCAACGCGTT AAGTCgacaa 1141 tcaacctctg gattacaaaa tttgtgaaag att