Transcript: Human NM_001347898.1

Homo sapiens thioredoxin related transmembrane protein 2 (TMX2), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TMX2 (51075)
Length:
1704
CDS:
97..792

Additional Resources:

NCBI RefSeq record:
NM_001347898.1
NBCI Gene record:
TMX2 (51075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347898.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298613 AGCTTGGTTAGACCTAGATTT pLKO_005 1335 3UTR 100% 13.200 18.480 N TMX2 n/a
2 TRCN0000064412 GAGAATGTGATCCGAGAATTT pLKO.1 830 3UTR 100% 13.200 10.560 N TMX2 n/a
3 TRCN0000286518 GAGAATGTGATCCGAGAATTT pLKO_005 830 3UTR 100% 13.200 10.560 N TMX2 n/a
4 TRCN0000298615 TATTCGCATGGGCCTACTTTA pLKO_005 423 CDS 100% 13.200 10.560 N TMX2 n/a
5 TRCN0000064408 CGGCCACAGATTGACAAGAAA pLKO.1 779 CDS 100% 5.625 4.500 N TMX2 n/a
6 TRCN0000064409 CCTGATGTTTCTCAGTGCCAT pLKO.1 300 CDS 100% 2.640 1.320 Y TMX2 n/a
7 TRCN0000064411 GCCTTCCTACTCGTGAGGAAA pLKO.1 199 CDS 100% 0.495 0.248 Y TMX2 n/a
8 TRCN0000286450 GCCTTCCTACTCGTGAGGAAA pLKO_005 199 CDS 100% 0.495 0.248 Y TMX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347898.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03194 pDONR223 100% 78% 69.7% None 603_604insGTTAGTACGCG;693_694ins184 n/a
2 ccsbBroad304_03194 pLX_304 0% 78% 69.7% V5 603_604insGTTAGTACGCG;693_694ins184 n/a
3 TRCN0000473472 CCCCGACGCTCTTGTGTCTGCTCA pLX_317 40.8% 78% 69.7% V5 603_604insGTTAGTACGCG;693_694ins184 n/a
Download CSV