Transcript: Mouse NM_025868.4

Mus musculus thioredoxin-related transmembrane protein 2 (Tmx2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tmx2 (66958)
Length:
2287
CDS:
322..1209

Additional Resources:

NCBI RefSeq record:
NM_025868.4
NBCI Gene record:
Tmx2 (66958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025868.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328597 CTATTCAACACTTGGATATTA pLKO_005 1495 3UTR 100% 15.000 21.000 N Tmx2 n/a
2 TRCN0000328535 TACATGGGTCCTGAGTATATC pLKO_005 715 CDS 100% 13.200 18.480 N Tmx2 n/a
3 TRCN0000328534 ACGTTAGCACACGGTACAAAG pLKO_005 923 CDS 100% 10.800 15.120 N Tmx2 n/a
4 TRCN0000328596 ACAACTGTTCAGGGCTAAATT pLKO_005 872 CDS 100% 15.000 10.500 N Tmx2 n/a
5 TRCN0000328537 TTCAACTTGAATGAGCTATAC pLKO_005 1084 CDS 100% 10.800 7.560 N Tmx2 n/a
6 TRCN0000125917 CCAATCCTTTGCTCCCATCTA pLKO.1 831 CDS 100% 4.950 3.465 N Tmx2 n/a
7 TRCN0000125914 CCCTAATGTTAGATGTCAGTA pLKO.1 1574 3UTR 100% 4.950 3.465 N Tmx2 n/a
8 TRCN0000125916 CCTACCCTGATTCTGTTCCAA pLKO.1 973 CDS 100% 3.000 2.100 N Tmx2 n/a
9 TRCN0000125918 GTAGGCAACATCTTTATGTTT pLKO.1 589 CDS 100% 0.563 0.394 N Tmx2 n/a
10 TRCN0000125915 CCTCACACTCTGCATAGTGTT pLKO.1 669 CDS 100% 0.495 0.347 N Tmx2 n/a
11 TRCN0000201006 CCAGAGATCCTGAGTTCAATT pLKO.1 1731 3UTR 100% 13.200 6.600 Y Ripply3 n/a
12 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 1739 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025868.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03194 pDONR223 100% 87.1% 92.5% None (many diffs) n/a
2 ccsbBroad304_03194 pLX_304 0% 87.1% 92.5% V5 (many diffs) n/a
3 TRCN0000473472 CCCCGACGCTCTTGTGTCTGCTCA pLX_317 40.8% 87.1% 92.5% V5 (many diffs) n/a
Download CSV