Construct: ORF TRCN0000473502
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018548.1_s317c1
- Derived from:
- ccsbBroadEn_02619
- DNA Barcode:
- TAACAACACCCCGGCCCGCTCGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRSS23 (11098)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473502
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11098 | PRSS23 | serine protease 23 | NM_001293179.2 | 100% | 100% | |
| 2 | human | 11098 | PRSS23 | serine protease 23 | NM_001293180.2 | 100% | 100% | |
| 3 | human | 11098 | PRSS23 | serine protease 23 | NM_007173.6 | 100% | 100% | |
| 4 | mouse | 76453 | Prss23 | protease, serine 23 | NM_029614.3 | 86.4% | 90.8% | (many diffs) |
| 5 | mouse | 76453 | Prss23 | protease, serine 23 | XM_006508304.3 | 86.4% | 90.8% | (many diffs) |
| 6 | mouse | 76453 | Prss23 | protease, serine 23 | XM_006508305.1 | 86.4% | 90.8% | (many diffs) |
| 7 | mouse | 76453 | Prss23 | protease, serine 23 | XM_006508303.3 | 84.8% | 89.2% | (many diffs) |
| 8 | mouse | 76453 | Prss23 | protease, serine 23 | XM_006508302.1 | 84.4% | 88.7% | (many diffs) |
| 9 | mouse | 76453 | Prss23 | protease, serine 23 | XM_006508299.3 | 77.8% | 81.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1215
- ORF length:
- 1149
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agggattcca gggctcctct tccttctctt ctttctgctc tgtgctgttg 121 ggcaagtgag cccttacagt gccccctgga aacccacttg gcctgcatac cgcctccctg 181 tcgtcttgcc ccagtctacc ctcaatttag ccaagccaga ctttggagcc gaagccaaat 241 tagaagtatc ttcttcatgt ggaccccagt gtcataaggg aactccactg cccacttacg 301 aagaggccaa gcaatatctg tcttatgaaa cgctctatgc caatggcagc cgcacagaga 361 cgcaggtggg catctacatc ctcagcagta gtggagatgg ggcccaacac cgagactcag 421 ggtcttcagg aaagtctcga aggaagcggc agatttatgg ctatgacagc aggttcagca 481 tttttgggaa ggacttcctg ctcaactacc ctttctcaac atcagtgaag ttatccacgg 541 gctgcaccgg caccctggtg gcagagaagc atgtcctcac agctgcccac tgcatacacg 601 atggaaaaac ctatgtgaaa ggaacccaga agcttcgagt gggcttccta aagcccaagt 661 ttaaagatgg tggTCGAGGG GCCAACGACT CCACTTCAGC CATGCCCGAG CAGATGAAAT 721 TTCAGTGGAT CCGGGTGAAA CGCACCCATG TGCCCAAGGG TTGGATCAAG GGCAATGCCA 781 ATGACATCGG CATGGATTAT GATTATGCCC TCCTGGAACT CAAAAAGCCC CACAAGAGAA 841 AATTTATGAA GATTGGGGTG AGCCCTCCTG CTAAGCAGCT GCCAGGGGGC AGAATTCACT 901 TCTCTGGTTA TGACAATGAC CGACCAGGCA ATTTGGTGTA TCGCTTCTGT GACGTCAAAG 961 ACGAGACCTA TGACTTGCTC TACCAGCAAT GCGATGCCCA GCCAGGGGCC AGCGGGTCTG 1021 GGGTCTATGT GAGGATGTGG AAGAGACAGC AGCAGAAGTG GGAGCGAAAA ATTATTGGCA 1081 TTTTTTCAGG GCACCAGTGG GTGGACATGA ATGGTTCCCC ACAGGATTTC AACGTGGCTG 1141 TCAGAATCAC TCCTCTCAAA TATGCCCAGA TTTGCTATTG GATTAAAGGA AACTACCTGG 1201 ATTGTAGGGA GGGGTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1261 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1321 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TAACAACACC CCGGCCCGCT 1381 CGATACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt