Transcript: Human NM_001293180.2

Homo sapiens serine protease 23 (PRSS23), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-03-29
Taxon:
Homo sapiens (human)
Gene:
PRSS23 (11098)
Length:
3728
CDS:
139..1290

Additional Resources:

NCBI RefSeq record:
NM_001293180.2
NBCI Gene record:
PRSS23 (11098)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001293180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032536 CCAGATTTGCTATTGGATTAA pLKO.1 1239 CDS 100% 13.200 18.480 N Prss23 n/a
2 TRCN0000047038 GCCAAGCAATATCTGTCTTAT pLKO.1 379 CDS 100% 13.200 18.480 N PRSS23 n/a
3 TRCN0000291263 GCCAAGCAATATCTGTCTTAT pLKO_005 379 CDS 100% 13.200 18.480 N PRSS23 n/a
4 TRCN0000047039 GCCCAGATTTGCTATTGGATT pLKO.1 1237 CDS 100% 4.950 6.930 N PRSS23 n/a
5 TRCN0000310084 GCCCAGATTTGCTATTGGATT pLKO_005 1237 CDS 100% 4.950 6.930 N PRSS23 n/a
6 TRCN0000047042 GCCGAAGCCAAATTAGAAGTA pLKO.1 301 CDS 100% 4.950 6.930 N PRSS23 n/a
7 TRCN0000291205 GCCGAAGCCAAATTAGAAGTA pLKO_005 301 CDS 100% 4.950 6.930 N PRSS23 n/a
8 TRCN0000047040 CCACTGCATACACGATGGAAA pLKO.1 660 CDS 100% 4.950 3.465 N PRSS23 n/a
9 TRCN0000291262 CCACTGCATACACGATGGAAA pLKO_005 660 CDS 100% 4.950 3.465 N PRSS23 n/a
10 TRCN0000047041 CGAGACCTATGACTTGCTCTA pLKO.1 1035 CDS 100% 4.050 2.835 N PRSS23 n/a
11 TRCN0000291207 CGAGACCTATGACTTGCTCTA pLKO_005 1035 CDS 100% 4.050 2.835 N PRSS23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02619 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02619 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473502 TAACAACACCCCGGCCCGCTCGAT pLX_317 47.2% 100% 100% V5 n/a
Download CSV