Transcript: Mouse XM_006508299.3

PREDICTED: Mus musculus protease, serine 23 (Prss23), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prss23 (76453)
Length:
1991
CDS:
106..1380

Additional Resources:

NCBI RefSeq record:
XM_006508299.3
NBCI Gene record:
Prss23 (76453)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032536 CCAGATTTGCTATTGGATTAA pLKO.1 1329 CDS 100% 13.200 18.480 N Prss23 n/a
2 TRCN0000032538 GCTTCCTGAAGCCCAAGTATA pLKO.1 806 CDS 100% 13.200 9.240 N Prss23 n/a
3 TRCN0000032537 GCCAAGCAGTACCTTTCCTAT pLKO.1 469 CDS 100% 4.950 3.465 N Prss23 n/a
4 TRCN0000047039 GCCCAGATTTGCTATTGGATT pLKO.1 1327 CDS 100% 4.950 3.465 N PRSS23 n/a
5 TRCN0000310084 GCCCAGATTTGCTATTGGATT pLKO_005 1327 CDS 100% 4.950 3.465 N PRSS23 n/a
6 TRCN0000032534 GCAGTTAGAATCACGCCTCTT pLKO.1 1300 CDS 100% 4.050 2.835 N Prss23 n/a
7 TRCN0000032535 CCTCAGTCTACCCTCAACTTA pLKO.1 352 CDS 100% 5.625 3.375 N Prss23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02619 pDONR223 100% 77.8% 81.8% None (many diffs) n/a
2 ccsbBroad304_02619 pLX_304 0% 77.8% 81.8% V5 (many diffs) n/a
3 TRCN0000473502 TAACAACACCCCGGCCCGCTCGAT pLX_317 47.2% 77.8% 81.8% V5 (many diffs) n/a
Download CSV