Construct: ORF TRCN0000473515
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011360.1_s317c1
- Derived from:
- ccsbBroadEn_09905
- DNA Barcode:
- ATTACTACAAAAGTAAACCCCGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CBARP (255057)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473515
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 255057 | CBARP | CACN subunit beta associate... | NM_152769.3 | 98.5% | 98.2% | 1_18del;767C>T;1112A>G |
2 | human | 255057 | CBARP | CACN subunit beta associate... | XM_017026559.1 | 77.6% | 77.3% | 1_384del;1133C>T;1478A>G |
3 | human | 255057 | CBARP | CACN subunit beta associate... | XR_001753654.1 | 62.7% | (many diffs) | |
4 | human | 255057 | CBARP | CACN subunit beta associate... | XM_017026556.1 | 57.7% | 57.5% | (many diffs) |
5 | human | 255057 | CBARP | CACN subunit beta associate... | XM_017026555.1 | 51.2% | 48.4% | (many diffs) |
6 | human | 255057 | CBARP | CACN subunit beta associate... | XM_017026560.1 | 36.1% | 35.4% | 1_384del;989_990ins41;1008_1009ins676 |
7 | human | 255057 | CBARP | CACN subunit beta associate... | XM_017026557.1 | 35.7% | 31.3% | (many diffs) |
8 | human | 255057 | CBARP | CACN subunit beta associate... | XM_017026558.1 | 35.7% | 31.3% | (many diffs) |
9 | human | 255057 | CBARP | CACN subunit beta associate... | XM_017026561.1 | 18.5% | 16.8% | (many diffs) |
10 | human | 255057 | CBARP | CACN subunit beta associate... | XM_017026562.1 | 18.5% | 16.8% | (many diffs) |
11 | mouse | 100503659 | Cbarp | calcium channel, voltage-de... | XM_006512973.2 | 68.5% | 70.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1407
- ORF length:
- 1341
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cacagccgcc accaccacca ccaccaccac tgccacagta gccctgacga 121 cgtcgtggga caatgccact ggacgcccca cggcagagcc agaccccatc ctggacaact 181 acgtgctgct ggtggtggtg atgtcgctgt tcgtgggggg cacgctggtg gtgttgtctg 241 gcgtcctgct cctctgcaag cgctgctggg acgtccacca gcgcctcaac agggccatgg 301 aggaagcgga gaagaccacc accacctacc tggacaacgg cacccaccca gcccaagacc 361 ccgacttccg gggagaggac cccgagtgcc aggatgcgga gaccgaacgc ttcctgtcca 421 ccagctccac gggccgccgg gtctccttca atgaggcggc gctgtttgag cagagccgca 481 agacgcagga caagggtcgc cggtacacac tgacggaggg ggacttccac cacctgaaga 541 atgcccggct cacgcacctg cacctgccgc ccctcaagat tgtcaccatc cacgagtgtg 601 actcaggcga ggccagctca gccaccacgc cccacccggc cacctctccc aaggccactc 661 tggccatctt ccagcccccg gggaaggccc tcaccggccg ctctgtgggc cccagctccg 721 ccctgccagg tgacccctac aactcagccg cgggcgccac tgacttcgca gagatcagcc 781 cctcggcatc tagcgactct ggggaaggca ccttgttgga tgccggtacc aggagcacca 841 aggctggagg gcccggggct gcagcagggc ctggggaggc gggcccggga tccggggcag 901 gtaccgttct gcagttcctc acccgcctgc gccgccatgc cagcctggat ggggccagcc 961 cctatttcaa ggtcaagaag tggaagctgg agcccagcca gcgggcagcc agtctggaca 1021 cgagaggTTC CCCCAAGCGG CACCACTTCC AGCGGCAGCG GGCAGCCAGT GAGAGCACGG 1081 AGCAGGAGGA GGGGGATGCC CCCCAGGAGG ACTTCATCCA GTACATTGCC CGGGCGGGCG 1141 ACGCCGTGGC CTTCCCGCGC CCCCGCCCCT TTCTGGCCAG CCCGCCCCCT GCTCTCGGCA 1201 GGTATTTTTC AGTAGATGGA GGTGCTAGGG GTGGACCTGT GGGCCCTTGC CCCCCTTCGC 1261 CCCCCCCTAG GCGGCCCAGG GAGCGCTCTC CAGGCCCCGT GGACACGCGC TCGCCTGCCT 1321 CCAGCGGCAA GGCCCCTCCC AGAGGCGGAC TCACTGGGGC CACCTCTCCA GCATGGACCA 1381 GAGGAGGGAA GCAGGGAGAG ACTGGGTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1441 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1501 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAATTACTAC 1561 AAAAGTAAAC CCCGTAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1621 aagatt