Transcript: Human XM_017026557.1

PREDICTED: Homo sapiens CACN subunit beta associated regulatory protein (CBARP), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CBARP (255057)
Length:
3892
CDS:
1213..3000

Additional Resources:

NCBI RefSeq record:
XM_017026557.1
NBCI Gene record:
CBARP (255057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282792 AGGACTTCATCCAGTACATTG pLKO_005 1739 CDS 100% 10.800 7.560 N CBARP n/a
2 TRCN0000180713 GACTTCCACCACCTGAAGAAT pLKO.1 1194 5UTR 100% 5.625 3.938 N CBARP n/a
3 TRCN0000179507 GAGGACTTCATCCAGTACATT pLKO.1 1738 CDS 100% 5.625 3.938 N CBARP n/a
4 TRCN0000263746 GGACTTCCACCACCTGAAGAA pLKO_005 1193 5UTR 100% 4.950 3.465 N CBARP n/a
5 TRCN0000263747 TTGTCACCATCCACGAGTGTG pLKO_005 1252 CDS 100% 4.050 2.835 N CBARP n/a
6 TRCN0000282791 TGACGACGTCGTGGGACAATG pLKO_005 787 5UTR 100% 3.600 2.520 N CBARP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09905 pDONR223 100% 35.7% 31.3% None (many diffs) n/a
2 TRCN0000473515 ATTACTACAAAAGTAAACCCCGTA pLX_317 28.6% 35.7% 31.3% V5 (many diffs) n/a
Download CSV