Construct: ORF TRCN0000473535
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014737.1_s317c1
- Derived from:
- ccsbBroadEn_04146
- DNA Barcode:
- ACGGAAAGATTCGGCCTACCCCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HDAC11 (79885)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473535
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79885 | HDAC11 | histone deacetylase 11 | NM_024827.4 | 100% | 100% | |
| 2 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_005265491.1 | 91.9% | 91.9% | 0_1ins84 |
| 3 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_011534131.1 | 91.9% | 91.9% | 0_1ins84 |
| 4 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_024453761.1 | 91.9% | 91.9% | 0_1ins84 |
| 5 | human | 79885 | HDAC11 | histone deacetylase 11 | NM_001136041.3 | 85.3% | 85.3% | 0_1ins84;166_167ins69 |
| 6 | human | 79885 | HDAC11 | histone deacetylase 11 | NM_001330636.2 | 77.2% | 77.2% | 247_248ins237 |
| 7 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_006713338.1 | 77.2% | 76.9% | 412_413ins237 |
| 8 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_024453762.1 | 73.1% | 72.6% | 1_57del;59G>T;469_470ins237 |
| 9 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_011534132.2 | 69.1% | 69.1% | 0_1ins84;163_164ins237 |
| 10 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_024453764.1 | 69.1% | 69.1% | 0_1ins84;163_164ins237 |
| 11 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_017007234.1 | 69.1% | 68.8% | 0_1ins84;328_329ins237 |
| 12 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_024453765.1 | 69.1% | 68.8% | 0_1ins84;328_329ins237 |
| 13 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_011534135.1 | 64.8% | 64.8% | 0_1ins366 |
| 14 | human | 79885 | HDAC11 | histone deacetylase 11 | XM_024453763.1 | 61.3% | 25.1% | (many diffs) |
| 15 | mouse | 232232 | Hdac11 | histone deacetylase 11 | NM_144919.2 | 87% | 92.2% | (many diffs) |
| 16 | mouse | 232232 | Hdac11 | histone deacetylase 11 | XM_017321536.1 | 33.7% | 33.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1107
- ORF length:
- 1041
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct acacacaacc cagctgtacc agcatgtgcc agagacacgc tggccaatcg 121 tgtactcgcc gcgctacaac atcaccttca tgggcctgga gaagctgcat ccctttgatg 181 ccggaaaatg gggcaaagtg atcaatttcc taaaagaaga gaagcttctg tctgacagca 241 tgctggtgga ggcgcgggag gcctcggagg aggacctgct ggtggtgcac acgaggcgct 301 atcttaatga gctcaagtgg tcctttgctg ttgctaccat cacagaaatc ccccccgtta 361 tcttcctccc caacttcctt gtgcagagga aggtgctgag gccccttcgg acccagacag 421 gaggaaccat aatggcgggg aagctggctg tggagcgagg ctgggccatc aacgtggggg 481 gtggcttcca ccactgctcc agcgaccgtg gcgggggctt ctgtgcctat gcggacatca 541 cgctcgccat caagtttctg tttgagcgtg tggagggcat cTCCAGGGCT ACCATCATTG 601 ATCTTGATGC CCATCAGGGC AATGGGCATG AGCGAGACTT CATGGACGAC AAGCGTGTGT 661 ACATCATGGA TGTCTACAAC CGCCACATCT ACCCAGGGGA CCGCTTTGCC AAGCAGGCCA 721 TCAGGCGGAA GGTGGAGCTG GAGTGGGGCA CAGAGGATGA TGAGTACCTG GATAAGGTGG 781 AGAGGAACAT CAAGAAATCC CTCCAGGAGC ACCTGCCCGA CGTGGTGGTA TACAATGCAG 841 GCACCGACAT CCTCGAGGGG GACCGCCTTG GGGGGCTGTC CATCAGCCCA GCGGGCATCG 901 TGAAGCGGGA TGAGCTGGTG TTCCGGATGG TCCGTGGCCG CCGGGTGCCC ATCCTTATGG 961 TGACCTCAGG CGGGTACCAG AAGCGCACAG CCCGCATCAT TGCTGACTCC ATACTTAATC 1021 TGTTTGGCCT GGGGCTCATT GGGCCTGAGT CACCCAGCGT CTCCGCACAG AACTCAGACA 1081 CACCGCTGCT TCCCCCTGCA GTGCCCTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1141 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1201 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAACGGAAAG 1261 ATTCGGCCTA CCCCGCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1321 aagatt