Transcript: Human XM_005265491.1

PREDICTED: Homo sapiens histone deacetylase 11 (HDAC11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDAC11 (79885)
Length:
2875
CDS:
183..1142

Additional Resources:

NCBI RefSeq record:
XM_005265491.1
NBCI Gene record:
HDAC11 (79885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199149 CCCGACGTGGTGGTATACAAT pLKO.1 849 CDS 100% 5.625 7.875 N HDAC11 n/a
2 TRCN0000330865 CCCGACGTGGTGGTATACAAT pLKO_005 849 CDS 100% 5.625 7.875 N HDAC11 n/a
3 TRCN0000017757 GACTCCATACTTAATCTGTTT pLKO.1 1038 CDS 100% 4.950 6.930 N HDAC11 n/a
4 TRCN0000330866 GACTCCATACTTAATCTGTTT pLKO_005 1038 CDS 100% 4.950 6.930 N HDAC11 n/a
5 TRCN0000196469 GCTACCATCATTGATCTTGAT pLKO.1 621 CDS 100% 4.950 6.930 N HDAC11 n/a
6 TRCN0000195479 CATTGATCTTGATGCCCATCA pLKO.1 629 CDS 100% 4.050 5.670 N HDAC11 n/a
7 TRCN0000017753 GCGCTATCTTAATGAGCTCAA pLKO.1 329 CDS 100% 4.050 5.670 N HDAC11 n/a
8 TRCN0000330863 GCGCTATCTTAATGAGCTCAA pLKO_005 329 CDS 100% 4.050 5.670 N HDAC11 n/a
9 TRCN0000195717 CCAGACAGGAGGAACCATAAT pLKO.1 446 CDS 100% 13.200 10.560 N HDAC11 n/a
10 TRCN0000330867 CCCAGAGCTGAAGAGCTATAG pLKO_005 1604 3UTR 100% 10.800 7.560 N HDAC11 n/a
11 TRCN0000017755 CGCATCATTGCTGACTCCATA pLKO.1 1026 CDS 100% 4.950 3.465 N HDAC11 n/a
12 TRCN0000017754 CTCGCCATCAAGTTTCTGTTT pLKO.1 576 CDS 100% 4.950 3.465 N HDAC11 n/a
13 TRCN0000017756 GCAAAGTGATCAATTTCCTAA pLKO.1 226 CDS 100% 4.950 3.465 N HDAC11 n/a
14 TRCN0000199352 CCCATCCTTATGGTGACCTCA pLKO.1 981 CDS 100% 2.640 1.848 N HDAC11 n/a
15 TRCN0000197158 GTTTCTGTTTGAGCGTGTGGA pLKO.1 587 CDS 100% 2.640 1.848 N HDAC11 n/a
16 TRCN0000330937 GTTTCTGTTTGAGCGTGTGGA pLKO_005 587 CDS 100% 2.640 1.848 N HDAC11 n/a
17 TRCN0000379651 TGGGATTTGCTGCCCTCTTTG pLKO_005 1582 3UTR 100% 10.800 6.480 N HDAC11 n/a
18 TRCN0000195716 CAACTTCCTTGTGCAGAGGAA pLKO.1 404 CDS 100% 0.264 0.158 N HDAC11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04146 pDONR223 100% 91.9% 91.9% None 0_1ins84 n/a
2 ccsbBroad304_04146 pLX_304 0% 91.9% 91.9% V5 0_1ins84 n/a
3 TRCN0000473535 ACGGAAAGATTCGGCCTACCCCGC pLX_317 50.5% 91.9% 91.9% V5 0_1ins84 n/a
Download CSV