Construct: ORF TRCN0000473539
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017112.3_s317c1
- Derived from:
- ccsbBroadEn_14538
- DNA Barcode:
- CAATATTCCATCCCCTGATACTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AKT1 (207)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473539
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 207 | AKT1 | AKT serine/threonine kinase 1 | NM_001014431.2 | 100% | 100% | |
| 2 | human | 207 | AKT1 | AKT serine/threonine kinase 1 | NM_001014432.1 | 100% | 100% | |
| 3 | human | 207 | AKT1 | AKT serine/threonine kinase 1 | NM_005163.2 | 100% | 100% | |
| 4 | human | 207 | AKT1 | AKT serine/threonine kinase 1 | XR_002957536.1 | 33% | (many diffs) | |
| 5 | mouse | 11651 | Akt1 | thymoma viral proto-oncogene 1 | NM_001331107.1 | 90.9% | 98.3% | (many diffs) |
| 6 | mouse | 11651 | Akt1 | thymoma viral proto-oncogene 1 | NM_009652.3 | 90.9% | 98.3% | (many diffs) |
| 7 | mouse | 11651 | Akt1 | thymoma viral proto-oncogene 1 | XM_006515415.1 | 90.9% | 98.3% | (many diffs) |
| 8 | mouse | 11651 | Akt1 | thymoma viral proto-oncogene 1 | NM_001165894.1 | 83.3% | 90.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1506
- ORF length:
- 1440
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cgacgtggct attgtgaagg agggttggct gcacaaacga ggggagtaca 121 tcaagacctg gcggccacgc tacttcctcc tcaagaatga tggcaccttc attggctaca 181 aggagcggcc gcaggatgtg gaccaacgtg aggctcccct caacaacttc tctgtggcgc 241 agtgccagct gatgaagacg gagcggcccc ggcccaacac cttcatcatc cgctgcctgc 301 agtggaccac tgtcatcgaa cgcaccttcc atgtggagac tcctgaggag cgggaggagt 361 ggacaaccgc catccagact gtggctgacg gcctcaagaa gcaggaggag gaggagatgg 421 acttccggtc gggctcaccc agtgacaact caggggctga agagatggag gtgtccctgg 481 ccaagcccaa gcaccgcgtg accatgaacg agtttgagta cctgaagctg ctgggcaagg 541 gcactttcgg caaggtgatc ctggtgaagg agaaggccac aggccgctac tacgccatga 601 agatcctcaa gaaggaagtc atcgtggcca aggacgaggt ggcccacaca ctcaccgaga 661 accgcgtcct gcagaactcc aggcacccct tcctcacagc cctgaagtac tctttccaga 721 cccacgaccg cctctgcttt gtcatggagt acgccaacgg gggcgagctg ttcttccacc 781 tgtcccggga gcgtgtgttc tccgaggacc gggcccgctt ctatggcgct gagattgtgt 841 cagccctgga ctacctgcac tcggagaaga acgtggtgta ccgggacctc aagctggaga 901 acctcatgct ggacaaggac gggcacatta agatcacaga cttcgggctg tgcaaggagg 961 ggatcaagga cggtgccacc atgaagacct tttgcggcac acctgagtac ctggcccccg 1021 aggtgctgga ggacaatgac tacggccgtg cagtggactg gtgggggctg ggcgtggtca 1081 tgtacgagat gatgtgcggt cgcctgccct tctacaacca ggaccatgag aagctttttg 1141 agctcatcct catggaggag atccgcttcc cgcgcacgct tggtcccgag gccaagtcct 1201 tgctttcagg gctgctcaag aaggacccca agcagaggct tggcgggggc tccgaggacg 1261 ccaaggagat catgcagcat cgcttcTTTG CCGGTATCGT GTGGCAGCAC GTGTACGAGA 1321 AGAAGCTCAG CCCACCCTTC AAGCCCCAGG TCACGTCGGA GACTGACACC AGGTATTTTG 1381 ATGAGGAGTT CACGGCCCAG ATGATCACCA TCACACCACC TGACCAAGAT GACAGCATGG 1441 AGTGTGTGGA CAGCGAGCGC AGGCCCCACT TCCCCCAGTT CTCCTACTCG GCCAGCGGCA 1501 CGGCCTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1561 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1621 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACAATATTCC ATCCCCTGAT ACTATACGCG 1681 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt