Transcript: Mouse NM_001165894.1

Mus musculus thymoma viral proto-oncogene 1 (Akt1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Akt1 (11651)
Length:
2657
CDS:
371..1837

Additional Resources:

NCBI RefSeq record:
NM_001165894.1
NBCI Gene record:
Akt1 (11651)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001165894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022935 CGTGTGACCATGAACGAGTTT pLKO.1 800 CDS 100% 4.950 6.930 N Akt1 n/a
2 TRCN0000304735 CGTGTGACCATGAACGAGTTT pLKO_005 800 CDS 100% 4.950 6.930 N Akt1 n/a
3 TRCN0000022937 TCTGAGACTGACACCAGGTAT pLKO.1 1661 CDS 100% 4.950 3.960 N Akt1 n/a
4 TRCN0000304683 TCTGAGACTGACACCAGGTAT pLKO_005 1661 CDS 100% 4.950 3.960 N Akt1 n/a
5 TRCN0000054707 CTACTTGCACTCCGAGAAGAA pLKO.1 1156 CDS 100% 4.950 3.465 N Akt1 n/a
6 TRCN0000054705 GTGGCAGGATGTGTATGAGAA pLKO.1 1606 CDS 100% 4.950 3.465 N Akt1 n/a
7 TRCN0000022936 TGGCACCTTTATTGGCTACAA pLKO.1 466 CDS 100% 4.950 3.465 N Akt1 n/a
8 TRCN0000304684 TGGCACCTTTATTGGCTACAA pLKO_005 466 CDS 100% 4.950 3.465 N Akt1 n/a
9 TRCN0000022934 GCACATCAAGATAACGGACTT pLKO.1 1228 CDS 100% 4.050 2.835 N Akt1 n/a
10 TRCN0000304736 GCACATCAAGATAACGGACTT pLKO_005 1228 CDS 100% 4.050 2.835 N Akt1 n/a
11 TRCN0000010163 CGAGTTTGAGTACCTGAAGCT pLKO.1 814 CDS 100% 2.640 1.848 N AKT1 n/a
12 TRCN0000054703 GCAGAACTCTAGGCATCCCTT pLKO.1 976 CDS 100% 2.640 1.848 N Akt1 n/a
13 TRCN0000022938 CCGCTTCTATGGTGCGGAGAT pLKO.1 1120 CDS 100% 1.350 0.945 N Akt1 n/a
14 TRCN0000039795 GCCACGCTACTTCCTCCTCAA pLKO.1 439 CDS 100% 1.350 0.945 N AKT1 n/a
15 TRCN0000054706 CCACAGTCATTGAGCGCACCT pLKO.1 612 CDS 100% 0.720 0.504 N Akt1 n/a
16 TRCN0000302357 CCACAGTCATTGAGCGCACCT pLKO_005 612 CDS 100% 0.720 0.504 N Akt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488923 CAAGAGACGTTTCTCGCTTCGGAA pLX_317 21.6% 84.9% 87.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489962 CGCTTCAACGAGGCTGAGACCTTG pLX_317 24.7% 84.5% 87.8% V5 (many diffs) n/a
3 ccsbBroadEn_00046 pDONR223 100% 83.3% 90.3% None (many diffs) n/a
4 ccsbBroad304_00046 pLX_304 43.5% 71.4% 55.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14538 pDONR223 0% 83.3% 90.3% None (many diffs) n/a
6 ccsbBroad304_14538 pLX_304 35.1% 83.3% 90.3% V5 (many diffs) n/a
7 TRCN0000473539 CAATATTCCATCCCCTGATACTAT pLX_317 15.7% 83.3% 90.3% V5 (many diffs) n/a
8 TRCN0000491814 GCGATCTATGAGTGTCTGACCAGA pLX_317 25.1% 83.2% 90.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV