Construct: ORF TRCN0000473546
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018840.3_s317c1
- Derived from:
- ccsbBroadEn_14624
- DNA Barcode:
- TTATGTTGTAGCAGATTTATTTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MARK2 (2011)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473546
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2011 | MARK2 | microtubule affinity regula... | NM_004954.5 | 99.6% | 99.4% | (many diffs) |
| 2 | human | 2011 | MARK2 | microtubule affinity regula... | NM_001163296.2 | 98.2% | 97.6% | (many diffs) |
| 3 | human | 2011 | MARK2 | microtubule affinity regula... | NM_001163297.2 | 97.6% | 97.3% | (many diffs) |
| 4 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544796.1 | 96% | 95.1% | (many diffs) |
| 5 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544795.1 | 95.8% | 95% | (many diffs) |
| 6 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544794.1 | 94.8% | 94% | (many diffs) |
| 7 | human | 2011 | MARK2 | microtubule affinity regula... | XM_017017311.1 | 94.7% | 93.5% | (many diffs) |
| 8 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544797.1 | 94.6% | 93.4% | (many diffs) |
| 9 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544798.1 | 94% | 93.1% | (many diffs) |
| 10 | human | 2011 | MARK2 | microtubule affinity regula... | NM_001039469.2 | 91.5% | 91.3% | (many diffs) |
| 11 | human | 2011 | MARK2 | microtubule affinity regula... | XM_017017310.1 | 90.8% | 90.6% | (many diffs) |
| 12 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544791.1 | 89.5% | 88.7% | (many diffs) |
| 13 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544790.1 | 89.4% | 88.6% | (many diffs) |
| 14 | human | 2011 | MARK2 | microtubule affinity regula... | NM_017490.4 | 88.5% | 88.3% | (many diffs) |
| 15 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544789.1 | 88.4% | 87.6% | (many diffs) |
| 16 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544792.1 | 88.2% | 87.1% | (many diffs) |
| 17 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544793.1 | 87.5% | 86.7% | (many diffs) |
| 18 | human | 2011 | MARK2 | microtubule affinity regula... | XR_949801.2 | 80.3% | (many diffs) | |
| 19 | human | 2011 | MARK2 | microtubule affinity regula... | XR_949802.2 | 71.3% | (many diffs) | |
| 20 | human | 2011 | MARK2 | microtubule affinity regula... | XR_002957128.1 | 46.8% | (many diffs) | |
| 21 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | NM_001080388.2 | 92.2% | 97.3% | (many diffs) |
| 22 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | NM_001080389.2 | 91.1% | 96.1% | (many diffs) |
| 23 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526652.3 | 88.8% | 92.3% | (many diffs) |
| 24 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526654.3 | 88.6% | 91.8% | (many diffs) |
| 25 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_017318058.1 | 87.9% | 91.4% | (many diffs) |
| 26 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_017318059.1 | 87.8% | 92.8% | (many diffs) |
| 27 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | NM_007928.3 | 85.8% | 90.6% | (many diffs) |
| 28 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526648.3 | 82.8% | 86.1% | (many diffs) |
| 29 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526647.2 | 82.6% | 85.9% | (many diffs) |
| 30 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526650.3 | 82.6% | 85.5% | (many diffs) |
| 31 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | NM_001080390.2 | 81.7% | 86.3% | (many diffs) |
| 32 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_011247139.1 | 79.7% | 84.4% | (many diffs) |
| 33 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526643.2 | 79.2% | 83.6% | (many diffs) |
| 34 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526642.3 | 78.2% | 81.3% | (many diffs) |
| 35 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526641.3 | 77.4% | 80.4% | (many diffs) |
| 36 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526644.3 | 75.4% | 79.7% | (many diffs) |
| 37 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526645.2 | 75.4% | 79.7% | (many diffs) |
| 38 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526646.3 | 75.4% | 79.7% | (many diffs) |
| 39 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526656.3 | 72% | 72.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2241
- ORF length:
- 2172
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtccagcgct cggacccccc tacccacgct gaacgagagg gacacggagc 121 agcccacctt gggacacctt gactccaagc ccagcagtaa gtccaacatg attcggggcc 181 gcaactcagc cacctctgct gatgagcagc cccacattgg aaactaccgg ctcctcaaga 241 ccattggcaa gggtaatttt gccaaggtga agttggcccg acacatcctg actgggaaag 301 aggtagctgt gaagatcatt gacaagactc aactgaactc ctccagcctc cagaaactat 361 tccgcgaagt aagaataatg aaggttttga atcatcccaa catagttaaa ttatttgaag 421 tgattgagac tgagaaaacg ctctaccttg tcatggagta cgctagtggc ggagaggtat 481 ttgattacct agtggctcat ggcaggatga aagaaaaaga ggctcgagcc aaattccgcc 541 agatagtgtc tgctgtgcag tactgtcacc agaagtttat tgtccataga gacttaaagg 601 cagaaaacct gctcttggat gctgatatga acatcaagat tgcagacttt ggcttcagca 661 atgaattcac ctttgggaac aagctggaca ccttctgtgg cagtccccct tatgctgccc 721 cagaactctt ccagggcaaa aaatatgatg gacccgaggt ggatgtgtgg agcctaggag 781 ttatcctcta tacactggtc agcggatccc tgccttttga tggacagaac ctcaaggagc 841 tgcgggaacg ggtacttgag ggaaaatacc gtattccatt ctacatgtcc acggactgtg 901 aaaacctgct taagaaattt ctcattctta atcccagcaa gagaggcact ttagagcaaa 961 tcatgaaaga tcgatggatg aatgtgggtc acgaagatga tgaactaaag ccttacgtgg 1021 agccactccc tgactacaag gacccccggc ggacagagct gatggtgtcc atgggttata 1081 cacgggaaga gatccaggac tcgctggtgg gccagagata caacgaggtg atggccacct 1141 atctgctcct gggctacaag agctccgagc tggaaggcga caccatcacc ctgaaacccc 1201 ggccttcagc tgatctgacc aatagcagcg ccccatcccc atcccacaag gtacagcgca 1261 gcgtgtcggc caatcccaag cagcggcgct tcagcgacca ggctggtcct gccattccca 1321 cctctaattc ttactctaag aagactcaga gtaacaacgc agaaaataag cggcctgagg 1381 aggaccggga gtcagggcgg aaagccagca gcacagccaa ggtgcctgcc agccccctgc 1441 ccggtctgga gaggaagccc accccccaaa ccccctccac gaacagcgtc ctctccacca 1501 gcacaaatcg aagcaggaat tccccacttt tggagcgggc cagcctcggc caggcctcca 1561 tccagaatgg caaagacagc acagcccccc agcgtgtccc tgttgcctcc ccatccgccc 1621 acaacatcag cagcagtggt ggagccccag accgaactaa cttcccccgg ggtgtgtcca 1681 gccgaagcac cttccatgct gggcagctcc gacaggtgcg ggaccagcag aatttgccct 1741 acggtgtgac cccagcctct ccctctggcc acagccaggg ccggcggggg gcctctggga 1801 gcatcttcag caagttcacc tccaagtttg tacgcaggaa ccTGAATGAA CCTGAAAGCA 1861 AAGACCGAGT GGAGACGCTC AGACCTCACG TGGTGGGCAG TGGCGGCAAC GACAAAGAAA 1921 AGGAAGAATT TCGGGAGGCC AAGCCCCGCT CCCTCCGCTT CACGTGGAGT ATGAAGACCA 1981 CGAGCTCCAT GGAGCCCAAC GAGATGATGC GGGAGATCCG CAAGGTGCTG GACGCGAACA 2041 GCTGCCAGAG CGAGCTGCAT GAGAAGTACA TGCTGCTGTG CATGCACGGC ACGCCGGGCC 2101 ACGAGGACTT CGTGCAGTGG GAGATGGAGG TGTGCAAACT GCCGCGGCTC TCTCTCAACG 2161 GGGTTCGATT TAAGCGGATA TCGGGCACCT CCATGGCCTT CAAAAACATT GCCTCCAAAA 2221 TAGCCAACGA GCTGAAGCTT TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 2281 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 2341 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTAT GTTGTAGCAG 2401 ATTTATTTAA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt