Construct: ORF TRCN0000473587
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003970.1_s317c1
- Derived from:
- ccsbBroadEn_03104
- DNA Barcode:
- CCCCGCCTCTATCGACCCGCTAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PYCR2 (29920)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473587
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 29920 | PYCR2 | pyrroline-5-carboxylate red... | NM_013328.4 | 100% | 100% | |
| 2 | human | 29920 | PYCR2 | pyrroline-5-carboxylate red... | NM_001271681.1 | 76.8% | 76.8% | 318_319ins222 |
| 3 | human | 5831 | PYCR1 | pyrroline-5-carboxylate red... | NM_001330523.1 | 56.5% | 58.4% | (many diffs) |
| 4 | human | 5831 | PYCR1 | pyrroline-5-carboxylate red... | XM_011523585.2 | 52.1% | 53.8% | (many diffs) |
| 5 | mouse | 69051 | Pycr2 | pyrroline-5-carboxylate red... | NM_133705.2 | 87.6% | 92.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1026
- ORF length:
- 960
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cgtgggcttc atcggggccg gccagctggc ctatgctctg gcgcggggct 121 tcacggccgc aggcatcctg tcggctcaca agataatagc cagctcccca gaaatgaacc 181 tgcccacggt gtccgcgctc aggaagatgg gtgtgaacct gacacgcagc aacaaggaga 241 cggtgaagca cagcgacgtc ctgtttctgg ctgtgaagcc acatatcatc cccttcatcc 301 tggatgagat tggggccgac gtgcaagcca gacacatcgt ggtctcctgt gcggctggtg 361 tcaccatcag ctctgtggag aagaagctga tggcattcca gccagccccc aaagtgattc 421 gctgcatgac caacacacct gtggtagtgc aggaaggcgc tacagtgtac gccacgggca 481 cccatgccct ggtggaggat gggcagctcc tggagcagct catgagcagc gtgggcttct 541 gcactgaggt ggaagaggac ctcatcgatg ccgtcacggg gctcagtggc agcgggcctg 601 ccTATGCATT CATGGCTCTG GACGCATTGG CTGATGGTGG GGTGAAGATG GGTTTGCCAC 661 GGCGCCTGGC AATCCAACTC GGGGCCCAGG CTTTGCTGGG AGCTGCCAAG ATGCTGCTGG 721 ACTCGGAGCA GCATCCATGC CAGCTTAAGG ACAATGTCTG CTCCCCTGGG GGAGCCACCA 781 TCCACGCCCT GCACTTTCTA GAGAGTGGGG GCTTCCGCTC TCTGCTCATC AATGCAGTTG 841 AGGCCTCCTG TATCCGAACA CGAGAGCTAC AGTCCATGGC CGACCAAGAA AAGATCTCCC 901 CAGCTGCCCT TAAGAAGACC CTCTTAGACA GAGTGAAGCT GGAATCCCCC ACAGTCTCCA 961 CACTGACCCC CTCCAGCCCA GGGAAGCTCC TCACAAGAAG CCTGGCCCTG GGAGGCAAGA 1021 AGGACTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1081 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1141 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACCCCGCCTC TATCGACCCG CTAGAACGCG 1201 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt