Transcript: Human NM_001271681.1

Homo sapiens pyrroline-5-carboxylate reductase 2 (PYCR2), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-10-07
Taxon:
Homo sapiens (human)
Gene:
PYCR2 (29920)
Length:
1549
CDS:
231..971

Additional Resources:

NCBI RefSeq record:
NM_001271681.1
NBCI Gene record:
PYCR2 (29920)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271681.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428388 TTCATGGCTCTGGACGCATTG pLKO_005 552 CDS 100% 6.000 8.400 N PYCR2 n/a
2 TRCN0000046369 CTGTCGGCTCACAAGATAATA pLKO.1 303 CDS 100% 15.000 10.500 N PYCR2 n/a
3 TRCN0000419657 GCTTTCTCTGAATTGGTAAAT pLKO_005 1371 3UTR 100% 13.200 9.240 N PYCR2 n/a
4 TRCN0000416600 GCAAGGAGAAAGCATGCTTAG pLKO_005 1074 3UTR 100% 6.000 4.200 N PYCR2 n/a
5 TRCN0000425764 AGTCCATGGCCGACCAAGAAA pLKO_005 814 CDS 100% 5.625 3.938 N PYCR2 n/a
6 TRCN0000046371 CCATGCCAGCTTAAGGACAAT pLKO.1 678 CDS 100% 4.950 3.465 N PYCR2 n/a
7 TRCN0000046370 CGTCCTGTTTCTGGCTGTGAA pLKO.1 422 CDS 100% 4.950 3.465 N PYCR2 n/a
8 TRCN0000046372 GACCCTCTTAGACAGAGTGAA pLKO.1 860 CDS 100% 4.950 3.465 N PYCR2 n/a
9 TRCN0000046368 GCCCTTAAGAAGACCCTCTTA pLKO.1 849 CDS 100% 0.495 0.347 N PYCR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271681.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03104 pDONR223 100% 76.8% 76.8% None 318_319ins222 n/a
2 ccsbBroad304_03104 pLX_304 0% 76.8% 76.8% V5 318_319ins222 n/a
3 TRCN0000473587 CCCCGCCTCTATCGACCCGCTAGA pLX_317 44.2% 76.8% 76.8% V5 318_319ins222 n/a
Download CSV