Transcript: Mouse NM_133705.2

Mus musculus pyrroline-5-carboxylate reductase family, member 2 (Pycr2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pycr2 (69051)
Length:
1615
CDS:
191..1153

Additional Resources:

NCBI RefSeq record:
NM_133705.2
NBCI Gene record:
Pycr2 (69051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042157 CCGAAGCAATAAGGACACTGT pLKO.1 349 CDS 100% 2.640 2.112 N Pycr2 n/a
2 TRCN0000046369 CTGTCGGCTCACAAGATAATA pLKO.1 263 CDS 100% 15.000 10.500 N PYCR2 n/a
3 TRCN0000445991 AGTCCATGGCTGACCAAGAAA pLKO_005 996 CDS 100% 5.625 3.938 N Pycr2 n/a
4 TRCN0000042154 GCTCAGGGAAACTCCTTACAA pLKO.1 1101 CDS 100% 5.625 3.938 N Pycr2 n/a
5 TRCN0000426004 GTCTGTGGAGAGCTTTAGTTA pLKO_005 1368 3UTR 100% 5.625 3.938 N Pycr2 n/a
6 TRCN0000042156 GTGGAGGAAGACCTCATTGAT pLKO.1 674 CDS 100% 5.625 3.938 N Pycr2 n/a
7 TRCN0000435397 GTTGCTGGGAGCAGCTAAGAT pLKO_005 817 CDS 100% 5.625 3.938 N Pycr2 n/a
8 TRCN0000436027 TGTCTCCTGCTGCCCTTAAGA pLKO_005 1020 CDS 100% 5.625 3.938 N Pycr2 n/a
9 TRCN0000042155 CACCATCAGTTCTGTGGAGAA pLKO.1 487 CDS 100% 4.050 2.835 N Pycr2 n/a
10 TRCN0000042153 GAAACGGGAATCCTCTGAATT pLKO.1 1431 3UTR 100% 0.000 0.000 N Pycr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03104 pDONR223 100% 87.6% 92.1% None (many diffs) n/a
2 ccsbBroad304_03104 pLX_304 0% 87.6% 92.1% V5 (many diffs) n/a
3 TRCN0000473587 CCCCGCCTCTATCGACCCGCTAGA pLX_317 44.2% 87.6% 92.1% V5 (many diffs) n/a
Download CSV