Construct: ORF TRCN0000473654
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017671.1_s317c1
- Derived from:
- ccsbBroadEn_00226
- DNA Barcode:
- ATGGAATTATCCGGCTATGAACCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CAV1 (857)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473654
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 857 | CAV1 | caveolin 1 | NM_001753.5 | 100% | 100% | |
2 | human | 857 | CAV1 | caveolin 1 | NM_001172895.1 | 82.5% | 82.5% | 0_1ins93 |
3 | human | 857 | CAV1 | caveolin 1 | NM_001172896.2 | 82.5% | 82.5% | 0_1ins93 |
4 | human | 857 | CAV1 | caveolin 1 | NM_001172897.2 | 82.5% | 82.5% | 0_1ins93 |
5 | mouse | 12389 | Cav1 | caveolin 1, caveolae protein | NM_007616.4 | 92.3% | 94.9% | (many diffs) |
6 | mouse | 12389 | Cav1 | caveolin 1, caveolae protein | XM_006504974.1 | 92.3% | 94.9% | (many diffs) |
7 | mouse | 12389 | Cav1 | caveolin 1, caveolae protein | NM_001243064.1 | 75.2% | 77.5% | (many diffs) |
8 | mouse | 12389 | Cav1 | caveolin 1, caveolae protein | XM_006504975.1 | 75.2% | 77.5% | (many diffs) |
9 | mouse | 12389 | Cav1 | caveolin 1, caveolae protein | XM_006504976.1 | 75.2% | 77.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 600
- ORF length:
- 534
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tgggggcaaa tacgtagact cggagggaca tctctacacc gttcccatcc 121 gggaacaggg caacatctac aagcccaaca acaaggccat ggcagacgag ctgagcgaga 181 agcaagtgta cgacgcgcac accaaggaga tcgacctggt caaccgcgac cctaaacacc 241 tcaacgatga cgtggtcaag attgactttg aagatgtgat tgcagaacca gaagggacac 301 acagttttga cggcatttgg aaggccagct tcaccacctt cactgtgacg aaatactggt 361 tttaccgctt gctgtctgcc ctctttggca tcccgatggC ACTCATCTGG GGCATTTACT 421 TCGCCATTCT CTCTTTCCTG CACATCTGGG CAGTTGTACC ATGCATTAAG AGCTTCCTGA 481 TTGAGATTCA GTGCATCAGC CGTGTCTATT CCATCTACGT CCACACCGTC TGTGACCCAC 541 TCTTTGAAGC TGTTGGGAAA ATATTCAGCA ATGTCCGCAT CAACTTGCAG AAAGAAATAT 601 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 661 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 721 TTTATATATC TTGTGGAAAG GACGAATGGA ATTATCCGGC TATGAACCCA CGCGTTAAGT 781 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt