Transcript: Mouse NM_001243064.1

Mus musculus caveolin 1, caveolae protein (Cav1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cav1 (12389)
Length:
2638
CDS:
305..748

Additional Resources:

NCBI RefSeq record:
NM_001243064.1
NBCI Gene record:
Cav1 (12389)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112660 CCAGTTAGATTTAGGGATTTA pLKO.1 1210 3UTR 100% 13.200 18.480 N Cav1 n/a
2 TRCN0000008002 GACGTGGTCAAGATTGACTTT pLKO.1 395 CDS 100% 4.950 6.930 N CAV1 n/a
3 TRCN0000315310 GACGTGGTCAAGATTGACTTT pLKO_005 395 CDS 100% 4.950 6.930 N CAV1 n/a
4 TRCN0000112664 GCTTCCTGATTGAGATTCAGT pLKO.1 618 CDS 100% 3.000 4.200 N Cav1 n/a
5 TRCN0000335750 GCTTCCTGATTGAGATTCAGT pLKO_005 618 CDS 100% 3.000 4.200 N Cav1 n/a
6 TRCN0000112663 TGAAGCTATTGGCAAGATATT pLKO.1 691 CDS 100% 13.200 9.240 N Cav1 n/a
7 TRCN0000335748 TGAAGCTATTGGCAAGATATT pLKO_005 691 CDS 100% 13.200 9.240 N Cav1 n/a
8 TRCN0000381954 AGAGCTTCCTGATTGAGATTC pLKO_005 615 CDS 100% 10.800 7.560 N CAV1 n/a
9 TRCN0000112661 CCGCTTGTTGTCTACGATCTT pLKO.1 511 CDS 100% 4.950 3.465 N Cav1 n/a
10 TRCN0000335671 CCGCTTGTTGTCTACGATCTT pLKO_005 511 CDS 100% 4.950 3.465 N Cav1 n/a
11 TRCN0000112662 CGACGTGGTCAAGATTGACTT pLKO.1 394 CDS 100% 4.950 3.465 N Cav1 n/a
12 TRCN0000335670 CGACGTGGTCAAGATTGACTT pLKO_005 394 CDS 100% 4.950 3.465 N Cav1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00226 pDONR223 100% 75.2% 77.5% None (many diffs) n/a
2 ccsbBroad304_00226 pLX_304 0% 75.2% 77.5% V5 (many diffs) n/a
3 TRCN0000473654 ATGGAATTATCCGGCTATGAACCC pLX_317 38% 75.2% 77.5% V5 (many diffs) n/a
Download CSV