Transcript: Human NM_001172897.2

Homo sapiens caveolin 1 (CAV1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CAV1 (857)
Length:
2426
CDS:
91..534

Additional Resources:

NCBI RefSeq record:
NM_001172897.2
NBCI Gene record:
CAV1 (857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315312 AGTGCATCAGCCGTGTCTATT pLKO_005 422 CDS 100% 13.200 18.480 N CAV1 n/a
2 TRCN0000380457 GCAGTTGTACCATGCATTAAG pLKO_005 382 CDS 100% 13.200 18.480 N CAV1 n/a
3 TRCN0000008002 GACGTGGTCAAGATTGACTTT pLKO.1 181 CDS 100% 4.950 6.930 N CAV1 n/a
4 TRCN0000315310 GACGTGGTCAAGATTGACTTT pLKO_005 181 CDS 100% 4.950 6.930 N CAV1 n/a
5 TRCN0000380792 GGGCATTTACTTCGCCATTCT pLKO_005 342 CDS 100% 4.950 6.930 N CAV1 n/a
6 TRCN0000008001 GACCCTAAACACCTCAACGAT pLKO.1 160 CDS 100% 3.000 2.400 N CAV1 n/a
7 TRCN0000381954 AGAGCTTCCTGATTGAGATTC pLKO_005 401 CDS 100% 10.800 7.560 N CAV1 n/a
8 TRCN0000008000 CCACCTTCACTGTGACGAAAT pLKO.1 266 CDS 100% 10.800 7.560 N CAV1 n/a
9 TRCN0000350508 CCACCTTCACTGTGACGAAAT pLKO_005 266 CDS 100% 10.800 7.560 N CAV1 n/a
10 TRCN0000382077 ACCGTCTGTGACCCACTCTTT pLKO_005 457 CDS 100% 4.950 3.465 N CAV1 n/a
11 TRCN0000011218 GACCCACTCTTTGAAGCTGTT pLKO.1 466 CDS 100% 4.050 2.835 N CAV1 n/a
12 TRCN0000112664 GCTTCCTGATTGAGATTCAGT pLKO.1 404 CDS 100% 3.000 2.100 N Cav1 n/a
13 TRCN0000335750 GCTTCCTGATTGAGATTCAGT pLKO_005 404 CDS 100% 3.000 2.100 N Cav1 n/a
14 TRCN0000007999 GCTTTGTGATTCAATCTGTAA pLKO.1 2229 3UTR 100% 4.950 2.970 N CAV1 n/a
15 TRCN0000315311 GCTTTGTGATTCAATCTGTAA pLKO_005 2229 3UTR 100% 4.950 2.970 N CAV1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00226 pDONR223 100% 82.5% 82.5% None 0_1ins93 n/a
2 ccsbBroad304_00226 pLX_304 0% 82.5% 82.5% V5 0_1ins93 n/a
3 TRCN0000473654 ATGGAATTATCCGGCTATGAACCC pLX_317 38% 82.5% 82.5% V5 0_1ins93 n/a
Download CSV