Construct: ORF TRCN0000473705
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008721.1_s317c1
- Derived from:
- ccsbBroadEn_01767
- DNA Barcode:
- GTTTCTTCAAGCTGCGCTTCCAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VDR (7421)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473705
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7421 | VDR | vitamin D receptor | NM_000376.3 | 100% | 100% | |
| 2 | human | 7421 | VDR | vitamin D receptor | NM_001017535.1 | 100% | 100% | |
| 3 | human | 7421 | VDR | vitamin D receptor | XM_006719587.3 | 100% | 100% | |
| 4 | human | 7421 | VDR | vitamin D receptor | XM_011538720.2 | 100% | 100% | |
| 5 | human | 7421 | VDR | vitamin D receptor | XM_024449178.1 | 94.8% | 94.8% | 1_69del |
| 6 | human | 7421 | VDR | vitamin D receptor | NM_001017536.2 | 89.5% | 89.5% | 1_150del |
| 7 | human | 7421 | VDR | vitamin D receptor | NM_001364085.1 | 86.4% | 100% | 1282_1482del |
| 8 | mouse | 22337 | Vdr | vitamin D (1,25-dihydroxyvi... | NM_009504.4 | 86.1% | 88% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1347
- ORF length:
- 1281
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggcaatggcg gccagcactt ccctgcctga ccctggagac tttgaccgga 121 acgtgccccg gatctgtggg gtgtgtggag accgagccac tggctttcac ttcaatgcta 181 tgacctgtga aggctgcaaa ggcttcttca ggcgaagcat gaagcggaag gcactattca 241 cctgcccctt caacggggac tgccgcatca ccaaggacaa ccgacgccac tgccaggcct 301 gccggctcaa acgctgtgtg gacatcggca tgatgaagga gttcattctg acagatgagg 361 aagtgcagag gaagcgggag atgatcctga agcggaagga ggaggaggcc ttgaaggaca 421 gtctgcggcc caagctgtct gaggagcagc agcgcatcat tgccatactg ctggacgccc 481 accataagac ctacgacccc acctactccg acttctgcca gttccggcct ccagttcgtg 541 tgaatgatgg tggagggagc catccttcca ggcccaactc cagacacact cccagcttct 601 ctggggactc ctcctcctcc tgctcagatc actgtatcac ctcttcagac atgatggact 661 cgtccagctt ctccaatctg gatctgagtg aagaagattc agatgaccct tctgtgaccc 721 tagagctgtc ccagctctcc atgctgcccc acctggctga cctggtcagt tacagcatcc 781 aaaaggtcat tggctttgct aagatgatac caggattcag agacctcacc tctgaggacc 841 agatcGTACT GCTGAAGTCA AGTGCCATTG AGGTCATCAT GTTGCGCTCC AATGAGTCCT 901 TCACCATGGA CGACATGTCC TGGACCTGTG GCAACCAAGA CTACAAGTAC CGCGTCAGTG 961 ACGTGACCAA AGCCGGACAC AGCCTGGAGC TGATTGAGCC CCTCATCAAG TTCCAGGTGG 1021 GACTGAAGAA GCTGAACTTG CATGAGGAGG AGCATGTCCT GCTCATGGCC ATCTGCATCG 1081 TCTCCCCAGA TCGTCCTGGG GTGCAGGACG CCGCGCTGAT TGAGGCCATC CAGGACCGCC 1141 TGTCCAACAC ACTGCAGACG TACATCCGCT GCCGCCACCC GCCCCCGGGC AGCCACCTGC 1201 TCTATGCCAA GATGATCCAG AAGCTAGCCG ACCTGCGCAG CCTCAATGAG GAGCACTCCA 1261 AGCAGTACCG CTGCCTCTCC TTCCAGCCTG AGTGCAGCAT GAAGCTAACG CCCCTTGTGC 1321 TCGAAGTGTT TGGCAATGAG ATCTCCTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1381 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGCCCGT 1441 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGTTTCTTC 1501 AAGCTGCGCT TCCAATACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1561 aagatt