Transcript: Human XM_011538720.2

PREDICTED: Homo sapiens vitamin D receptor (VDR), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VDR (7421)
Length:
1476
CDS:
193..1476

Additional Resources:

NCBI RefSeq record:
XM_011538720.2
NBCI Gene record:
VDR (7421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019504 CGAAGTGTTTGGCAATGAGAT pLKO.1 1449 CDS 100% 4.950 6.930 N VDR n/a
2 TRCN0000019505 GTCATCATGTTGCGCTCCAAT pLKO.1 1000 CDS 100% 4.950 6.930 N VDR n/a
3 TRCN0000019508 CGCGTCAGTGACGTGACCAAA pLKO.1 1078 CDS 100% 1.650 2.310 N VDR n/a
4 TRCN0000276541 TCCTGCTCAGATCACTGTATC pLKO_005 745 CDS 100% 10.800 8.640 N VDR n/a
5 TRCN0000277001 ATGAAGCGGAAGGCACTATTC pLKO_005 346 CDS 100% 10.800 7.560 N VDR n/a
6 TRCN0000276544 TTGGCTTTGCTAAGATGATAC pLKO_005 917 CDS 100% 10.800 7.560 N VDR n/a
7 TRCN0000019506 CCTCCAGTTCGTGTGAATGAT pLKO.1 655 CDS 100% 5.625 3.938 N VDR n/a
8 TRCN0000276542 CCTCCAGTTCGTGTGAATGAT pLKO_005 655 CDS 100% 5.625 3.938 N VDR n/a
9 TRCN0000019507 CCCTGGAGACTTTGACCGGAA pLKO.1 228 CDS 100% 0.720 0.504 N VDR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01767 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01767 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473705 GTTTCTTCAAGCTGCGCTTCCAAT pLX_317 39.3% 100% 100% V5 n/a
4 TRCN0000489764 CTGGAGACAAGTGCGACAGCCATA pLX_317 27.1% 99.9% 99.7% V5 1281_1282insG n/a
5 TRCN0000488926 TTATCGAGACCACCCAACCGAGGC pLX_317 27.5% 99.2% 99.2% V5 (not translated due to prior stop codon) 1_9delATGGAGGCA n/a
6 TRCN0000489501 GGAGTCCCATGAATCCTTAGGTGA pLX_317 28.6% 99.2% 99% V5 1_9delATGGAGGCA;1281_1282insG n/a
Download CSV