Construct: ORF TRCN0000473723
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002411.1_s317c1
- Derived from:
- ccsbBroadEn_00431
- DNA Barcode:
- CATCCTTGGTCAACCAGGTCATTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DDX6 (1656)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473723
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1656 | DDX6 | DEAD-box helicase 6 | NM_001257191.2 | 100% | 100% | |
2 | human | 1656 | DDX6 | DEAD-box helicase 6 | NM_004397.6 | 100% | 100% | |
3 | human | 1656 | DDX6 | DEAD-box helicase 6 | XM_005271417.4 | 100% | 100% | |
4 | human | 1656 | DDX6 | DEAD-box helicase 6 | XM_024448377.1 | 100% | 100% | |
5 | human | 1656 | DDX6 | DEAD-box helicase 6 | XM_011542644.1 | 91% | 91% | 863_864ins129 |
6 | human | 1656 | DDX6 | DEAD-box helicase 6 | XM_017017251.1 | 91% | 91% | 863_864ins129 |
7 | human | 1656 | DDX6 | DEAD-box helicase 6 | XM_011542645.1 | 89.8% | 89.8% | 497_498ins147 |
8 | mouse | 13209 | Ddx6 | DEAD (Asp-Glu-Ala-Asp) box ... | NM_001110826.1 | 93.5% | 97.7% | (many diffs) |
9 | mouse | 13209 | Ddx6 | DEAD (Asp-Glu-Ala-Asp) box ... | NM_007841.4 | 93.5% | 97.7% | (many diffs) |
10 | mouse | 13209 | Ddx6 | DEAD (Asp-Glu-Ala-Asp) box ... | NM_181324.3 | 93.5% | 97.7% | (many diffs) |
11 | mouse | 13209 | Ddx6 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_011242391.2 | 93.5% | 97.7% | (many diffs) |
12 | mouse | 13209 | Ddx6 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_011242392.2 | 93.5% | 97.7% | (many diffs) |
13 | mouse | 13209 | Ddx6 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_017313124.1 | 93.5% | 97.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1515
- ORF length:
- 1449
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cacggccaga acagagaacc ctgttataat gggtctgtcc agtcaaaatg 121 gtcagctgag aggccctgtg aaacccactg gtggccctgg aggagggggc acacagacac 181 agcaacagat gaaccagctg aaaaacacca acacaatcaa taatggcact cagcagcaag 241 cacagagtat gaccaccact attaaacctg gtgatgactg gaaaaagact ttaaaactcc 301 ctccaaagga tctaagaatc aaaacttcgg atgtgacctc cacaaaagga aatgagtttg 361 aagattactg tttgaaacgg gagttactga tgggaatttt tgaaatgggc tgggaaaagc 421 catctcctat tcaggaggag agcattccca ttgctttatc tggtagggat atcttagcta 481 gagcaaaaaa tggaacaggc aagagcggtg cctacctcat tcccttactt gaacggctag 541 acctgaagaa ggacaatata caagcaatgg tgattgttcc cactagagaa cttgctctac 601 aggtcagtca aatttgcatc caggtcagca aacacatggg aggggccaaa gtgatggcaa 661 ccacaggagg aaccaattta cgagatgaca taatgaggct tgatgataca gtgcacgtgg 721 tgattgctac ccctgggaga atcctggatc ttattaagaa aggagtagca aaggttgatc 781 atgtccagat gatagtattg gatgaggcag ataagttgct gtcacaggat tttgtgcaga 841 taatggagga tattattctc acgctaccta aaaacaggca gattttacta tattccgcta 901 ctttccctct tagtgtacag aagttcatga attcccattt gcagaaaccc tatgagatta 961 acctgatgga ggaactaact ctgaagggag taacccagta ctacgcatat gtaactgagc 1021 gccaaaaagt acactgcctc aacacacttt tctccaggct tcagataaac cagtcgatca 1081 ttttctgtaa ctcctcTCAG CGAGTTGAAT TGCTAGCCAA GAAGATTTCT CAACTGGGTT 1141 ATTCTTGCTT CTATATTCAT GCTAAAATGA GGCAGGAACA TCGAAATCGT GTATTTCATG 1201 ATTTCCGAAA TGGCTTATGC CGCAATCTTG TTTGCACTGA TCTGTTTACC CGAGGTATTG 1261 ATATACAAGC TGTGAATGTG GTAATAAACT TTGATTTCCC AAAGCTGGCA GAGACCTATC 1321 TCCATCGTAT TGGAAGATCA GGTCGCTTTG GTCATCTTGG CTTAGCCATC AACTTGATCA 1381 CATATGATGA TCGCTTCAAC CTGAAAAGTA TTGAGGAGCA GCTGGGAACA GAAATTAAAC 1441 CTATTCCGAG CAACATTGAT AAGAGCCTGT ATGTGGCAGA ATACCACAGC GAGCCTGTAG 1501 AAGATGAGAA ACCTTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1561 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1621 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CATCCTTGGT CAACCAGGTC 1681 ATTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt