Transcript: Mouse XM_017313124.1

PREDICTED: Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 (Ddx6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ddx6 (13209)
Length:
2661
CDS:
500..1951

Additional Resources:

NCBI RefSeq record:
XM_017313124.1
NBCI Gene record:
Ddx6 (13209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074696 CTGATCTGTTTACCCGAGGTA pLKO.1 1671 CDS 100% 2.640 3.696 N DDX6 n/a
2 TRCN0000103603 TCAGATAAACCAGTCCATCAT pLKO.1 1495 CDS 100% 4.950 3.960 N Ddx6 n/a
3 TRCN0000103602 GTGCTAGATGAGGCAGATAAA pLKO.1 1229 CDS 100% 13.200 9.240 N Ddx6 n/a
4 TRCN0000103601 CCAAAGGATCTAAGAATCAAA pLKO.1 737 CDS 100% 5.625 3.938 N Ddx6 n/a
5 TRCN0000074694 CGCAATCTTGTTTGCACTGAT pLKO.1 1655 CDS 100% 4.950 3.465 N DDX6 n/a
6 TRCN0000103600 GACAAACTACAGAAGGCTCTT pLKO.1 1964 3UTR 100% 4.050 2.835 N Ddx6 n/a
7 TRCN0000103604 GCAGATAATGGAGGATATTAT pLKO.1 1270 CDS 100% 1.500 1.050 N Ddx6 n/a
8 TRCN0000074695 CCCACTAGAGAACTTGCTCTA pLKO.1 1013 CDS 100% 0.405 0.284 N DDX6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00431 pDONR223 100% 93.5% 97.7% None (many diffs) n/a
2 ccsbBroad304_00431 pLX_304 0% 93.5% 97.7% V5 (many diffs) n/a
3 TRCN0000473723 CATCCTTGGTCAACCAGGTCATTC pLX_317 29.2% 93.5% 97.7% V5 (many diffs) n/a
Download CSV