Construct: ORF TRCN0000473730
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004187.1_s317c1
- Derived from:
- ccsbBroadEn_13223
- DNA Barcode:
- ACGAAGTGACAGATCGCCCCAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPNE8 (144402)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473730
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 144402 | CPNE8 | copine 8 | XM_017018852.1 | 57.8% | 57.8% | 1_510del |
| 2 | human | 144402 | CPNE8 | copine 8 | NM_153634.3 | 41.3% | 41.3% | 1_993del |
| 3 | human | 144402 | CPNE8 | copine 8 | XR_245896.4 | 27.2% | 1_1050del;1329_1465del;1700_1701ins186 | |
| 4 | human | 144402 | CPNE8 | copine 8 | XR_944501.3 | 19.7% | 1_1050del;1201_1311del;1861_3545del | |
| 5 | mouse | 66871 | Cpne8 | copine VIII | XM_006521286.3 | 46.5% | 52.8% | (many diffs) |
| 6 | mouse | 66871 | Cpne8 | copine VIII | XM_006521285.1 | 40.1% | 45.5% | (many diffs) |
| 7 | mouse | 66871 | Cpne8 | copine VIII | NM_025815.2 | 35.5% | 40.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 765
- ORF length:
- 699
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tccttaccaa ctgaatgcct atggtatggc actaaaagca gtgggagaaa 121 ttgttcaaga ttatgacagt gataaaatgt ttccagctct aggatttggt gcaaaactgc 181 ctccagatgg aaggatatct cacgaatttg ctttgaatgg gaatcctcaa aacccctact 241 gtgatggcat tgagggggtc atggaggctt attacaggag tctgaaatct gtacaactat 301 atgggcccac caactttgct cctgtaatta atcatgtagc aagatatgct tcttctgtaa 361 aggatggctc ccagtatttt gtgcttctga ttgttacaga tggtgttatc tcagatatgg 421 cccagactaa ggagtccata gttaatgcct caaaacttcc aatgtcaata attatagtag 481 gtgttggacc agcagaattt gatgcaatgg tcgaattgga tGGAGATGAT GTAAGAGTCT 541 CCTCTAGAGG AAAATATGCT GAAAGAGACA TTGTGCAGTT TGTGCCATTC AGGGATTATA 601 TTGACAGAAG TGGAAACCAC ATACTGAGCA TGGCTAGATT GGCTAAAGAT GTCCTAGCTG 661 AGATCCCTGA GCAGTTTCTC TCCTATATGA GAGCCCGAGG AATCAAGCCA TCACCTGCGC 721 CTCCCCCATA CACCCCACCT ACACATGTGT TACAGACTCA AATATGCCCA ACTTTCTTGT 781 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 841 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 901 GAAAGGACGA ACGAAGTGAC AGATCGCCCC AGATACGCGT TAAGTCgaca atcaacctct 961 ggattacaaa atttgtgaaa gatt